Senin, 31 Desember 2012

Ada Apa Dengan Ideologi Nasionalisme


Semenjak runtuhnya tatanan kenegaraan Islam alias Khilafah Islamiyyah pada tahun 1924 atau 1342 Hijriyyah, maka dunia menyaksikan berdirinya berbagai Nation State atau Negara Kebangsaan. Bangsa-bangsa Muslim membangun negara di negerinya masing-masing dengan menjadikan nasionalisme sebagai landasan kehidupan berbangsa dan bernegara. Suatu perubahan yang sangat signifikan dan mendasar jika dibandingkan dengan tatanan kenegaraan sebelumnya dimana Khilafah Islamiyyah menjadi sebuah sistem yang mempersatukan segenap ummat Islam berdasarkan kesatuan aqidah Islamiyyah dan dengan sendirinya kesatuan fikrah Islamiyyah alias ideologi Islam.

Dalam tatanan kenegaraan Negara Kebangsaan faktor bangsa menjadi sebab persatuan dan kesatuan. Sedangkan dalam sistem Khilafah Islamiyyah faktor Islam sebagai keyakinan dan ideologi menjadi sebab persatuan dan kesatuan. Maka dengan sendirinya kita menyaksikan mengapa sejak munculnya berbagai Nation State di tengah kehidupan bernegara ummat Islam terjadilah degradasi penghayatan Islam sebagai ideologi dan peningkatan penghayatan ideologi kebangsaan di dalam diri banyak ummat Islam.

Sesungguhnya Islam tidak menafikan kehadiran bangsa dalam kehidupan ummat manusia. Hadirnya aneka jenis bangsa adalah suatu keniscayaan dalam realitas sosial masyarakat dunia. Al-Qur’an mengakui kenyataan ini.

يَا أَيُّهَا النَّاسُ إِنَّا خَلَقْنَاكُمْ مِنْ ذَكَرٍ وَأُنْثَى وَجَعَلْنَاكُمْ شُعُوبًا
وَقَبَائِلَ لِتَعَارَفُوا إِنَّ أَكْرَمَكُمْ عِنْدَ اللَّهِ أَتْقَاكُمْ إِنَّ اللَّهَ عَلِيمٌ خَبِيرٌ

”Hai manusia, sesungguhnya Kami menciptakan kamu dari seorang laki-laki dan seorang perempuan dan menjadikan kamu berbangsa-bangsa dan bersuku-suku supaya kamu saling kenal mengenal. Sesungguhnya orang yang paling mulia di antara kamu di sisi Allah ta’aala ialah orang yang paling bertakwa di antara kamu. Sesungguhnya Allah ta’aala Maha Mengetahui lagi Maha Mengenal.” (QS Al-Hujurat ayat 13)

Namun Islam tidak pernah memandang bahwa mulia-hinanya seseorang atau sekelompok orang ditentukan oleh faktor bangsa. Lain halnya dengan urusan taqwa dan aqidah. Islam sangat peduli dengan beriman-tidaknya seseorang atau sekelompok orang. Suatu masyarakat yang terdiri atas kumpulan orang-orang beriman dipandang sebagai masyarakat yang mulia di mata Allah ta’aala. Sedangkan masyarakat yang ingkar alias kafir adalah masyarakat yang hina di mata Allah ta’aala, betapapun secara material dan teknologi ia merupakan masyarakat maju.

إِنَّ لِلْمُتَّقِينَ عِنْدَ رَبِّهِمْ جَنَّاتِ النَّعِيمِ أَفَنَجْعَلُ
الْمُسْلِمِينَ كَالْمُجْرِمِينَ مَا لَكُمْ كَيْفَ تَحْكُمُونَ

“Sesungguhnya bagi orang-orang yang bertakwa (disediakan) surga-surga yang penuh keni’matan di sisi Tuhannya. Maka apakah patut Kami menjadikan orang-orang Islam itu sama dengan orang-orang yang berdosa (orang kafir)? Mengapa kamu (berbuat demikian): bagaimanakah kamu mengambil keputusan?” (QS Al-Qolam ayat 34-36)

Khilafah Islamiyyah merupakan tatanan kehidupan bernegara ummat Islam yang mempersatukan segenap kaum muslimin dari ujung timur hingga ujung barat bumi Allah ta’aala. Penghayatan siapa yang menjadi in-group atau out-group ummat adalah aqidah Islamiyah. Sedangkan dalam kehidupan Negara Kebangsaan maka siapa yang dianggap sebagai in-group bangsa adalah siapapun, apapun keyakinan dan agamanya, asalkan ia sebangsa dan setanah-air, maka ia dianggap sebagai saudara sebangsa. Siapapun yang di luar negaranya dan bangsanya dianggap sebagai out-group kendati ia memiliki aqidah Islamiyyah yang serupa dengan aqidahnya.

Maka wajarlah bilamana seorang Muslim yang menerima dengan sukarela apalagi dengan sungguh-sungguh faham Nasionalisme akan cenderung menjadi sulit menampilkan ideologi Islam sebagai identitas pertama dan utamanya. Ia akan cenderung mendegradasikan identitas Islamnya demi menjaga persatuan dan kesatuan dengan sesama ”anak bangsa” yang beraneka ragam latar belakang keyakinan dan agama. Dan orang seperti ini akan sulit untuk bisa memandang kaum muslimin di luar bangsanya sebagai saudara seiman yang harus lebih dia utamakan daripada saudara sebangsa dan setanah-airnya.

Padahal ketika sudah masuk liang lahat malaikat samasekali tidak akan menanyakan soal identitas bangsa jenazah. Tetapi jelas ia akan ditanya soal identitas agamanya. Sebagaimana disebutkan dalam hadits di bawah ini:

فَتُعَادُ رُوحُهُ فِي جَسَدِهِ فَيَأْتِيهِ مَلَكَانِ فَيُجْلِسَانِهِ فَيَقُولَانِ لَهُ
مَنْ رَبُّكَ فَيَقُولُ رَبِّيَ اللَّهُ فَيَقُولَانِ لَهُ مَا دِينُكَ فَيَقُولُ دِينِيَ الْإِسْلَامُ

Maka ruhnya dikembalikan ke jasadnya, datang dua malaikat bertanya:”Siapa rabbmu?” Dia menjawab:”Rabbku Allah”, lalu :”Apa diin(agama)-mu?” Dia jawab:”Diin-ku Islam.” (HR Ahmad)

Ya. Allah, jadikanlah kami benar-benar ridha akan Islam sebagai agama, identitas dan ideologi kami tanpa perlu di embel-embeli dengan identitas dan ideologi lainnya. Ya Allah, kami yakin bahwa ajaranMu sudah sempurna dan lengkap.

رَضِيتُ بِاللَّهِ رَبًّا وَبِمُحَمَّدٍ رَسُولًا وَبِالْإِسْلَامِ دِينًا

“Aku ridha Allah sebagai Rabbku, Muhammad shollallahu ’alaih wa sallam sebagai Rasul dan Islam sebagai Agama.”

Read More..

Minggu, 30 Desember 2012

Bahaya Kemunculan Puncak Fitnah Dajjal


oleh Ust. Ihsan Tandjung

Banyak manusia dewasa ini yang tidak peduli akan puncak fitnah yang bakal datang di akhir zaman. Dajjal menjadi fenomena yang dianggap sekedar mitos. Bahkan banyak yang menganggap Dajjal tidak ada. Sehingga banyak manusia yang melupakannya dan tidak pernah peduli untuk membicarakannya.

Ketika pengabaian ini terjadi di kalangan orang awam ia sudah menjadi suatu masalah. Namun realitasnya lebih jauh daripada itu. Bahkan kita menyaksikan dewasa ini para pemberi peringatan seperti para muballigh, penceramah, ustadz dan kebanyakan ulama tidak lagi peduli untuk memperingatkan ummat akan bahaya fitnah Dajjal. Padahal bilamana kedua gejala ini sudah tampak, maka Rasulullah justru mengatakan bahwa pada saat seperti itulah Dajjal bakal keluar.




“Dajjal tidak akan muncul sehingga manusia melupakannya dan para Imam meninggalkan untuk mengingatnya di atas mimbar-mimbar.” (HR Ahmad 16073)


Nabi Muhammad shallallahu ’alaih wa sallam bersabda bahwa pada saat kebanyakan orang awam melupakan perkara Dajjal dan para Imam tidak lagi memperingatkan ummat akan bahaya puncak fitnah Dajjal, maka ketika itulah justru Dajjal bakal keluar. Sedangkan realitas dunia kita dewasa ini sudah mengandung kedua fenomena tersebut. Artinya, sudah saatnya kita waspada mengantisipasi kemunculan Dajjal yang bila-bila masa dewasa ini akan keluar.

Dalam sebuah hadits riwayat Imam Ahmad Nabi Muhammad shallallahu ’alaih wa sallam menjelaskan ciri khas Dajjal kepada ummatnya yang belum pernah dijelaskan oleh para Nabi sebelumnya kepada ummatnya masing-masing. Beliau menegaskan bahwa Dajjal itu bermata dua namun salah satunya cacat alias buta sehingga yang ada/berfungsi hanyalah satu mata saja.

"Dan sesungguhnya Dajjal itu bermata satu; sebelah matanya tidak nampak. Di antara kedua matanya tertulis "kafir" yg terbaca oleh setiap mu’min yg mengerti baca-tulis ataupun tidak."(HR Ahmad)


Hadits di atas mengingatkan kita akan suatu simbol yang tertera pada lembar uang kertas satu dollar Amerika Serikat (one dollar bill). Di dalamnya kita lihat sebuah gambar yang disebut sebagai The Great Seal (Meterai Yang Agung). Gambar ini sarat makna dan isyarat. Kata-kata berbahasa Latin Novus Ordo Seclorum berarti the New World Order (Tatanan Dunia Baru). Sedangkan di atas tulisan tersebut ada gambar primada yang tidak sempurna karena bagian pucuknya terpotong.

Lalu di atas piramida itu ada sebuah segitga yang berukuran persis sesuai untuk diletakkan menjadi pucuk piramida. Di dalam segitiga tersebut terdapat gambar mata tunggal. Lalu di atas segitiga bermata tunggal itu ada tulisan Latin Annuit Coeptis yang berarti “the Eye of Providence has approved of (our) undertakings.” (si Mata Tunggal telah merestui usaha-usaha kami).

Jika kita tafsirkan gambar di atas, maka ia bisa bermakna bahwa dunia sedang diarahkan menjadi sebuah sistem yang berstruktur bak piramida yang belum memiliki pucuk. Struktur dunia yang belum mempunyai pemimpin tertinggi. Namun pemimpin tersebut sedang dinanti-nantikan kehadirannya. Dan struktur dunia yang dirancang menjadi the New World Order tersebut menantikan kedatangan pemimpinnya yang bersimbolkan si Mata Satu (Dajjal?).

Seluruh upaya mewujdukan dan memapankan the New World Order merupakan rangkaian usaha untuk meraih keridhaan dan restu dari si Mata Satu alias Dajjal. Dengan kata lain Tatanan Dunia Baru ini adalah sebuah proyek persembahan kolosal untuk menyambut kedatangan puncak fitnah yaitu Dajjal…!

Segenap dimensi kehidupan modern dewasa ini adalah dalam rangka mewujudkan the New World Order (Tatanan Dunia Baru). Sebuah sistem yang tidak berlandaskan nilai-nilai keimanan bahkan dipengaruhi sangat oleh nilai-nilai kekufuran, nilai-nilai Dajjal. ”We are living in a Godless Civilization,” demikian ungkap Imron Hosein, mantan Imam Masjid PBB New York.

Bahkan Ahmad Thompson, seorang penulis Muslim berkebangsaan Inggris jelas-jelas menyatakan bahwa dunia modern semenjak hampir satu abad yang lalu (sejak runtuhnya Khilafah Islamiyah terakhir) membentuk diriya menjadi sebuah Sistem Dajjal. Suatu sistem sarat Dajjalic Values dimana jika oknum Dajjal muncul pada masa sekarang ini, maka ia akan segera dinobatkan menjadi pimpinan Sistem Dajjal yang telah tersedia.

Inilah yang dikhawatirkan Rasulullah. Bila rangkaian fitnah telah bermunculan menjelang datangnya Dajjal, maka manusia akan mengalami proses seleksi. Barangsiapa yang sanggup istiqomah menghindarkan diri dan keluarganya dari rangkaian fitnah tersebut, maka ia bakal sanggup terbebaskan dari puncak fitnah, yakni Dajjal.

Dan sebaliknya, barangsiapa yang malah ikut serta menyemarakkan rangkaian fitnah sebelum datangnya Dajjal, niscaya ia akan sangat mudah menjadi sasaran tipudaya Dajjal. Barangsiapa yang tanpa jiwa kritis menerima bahkan mendukung the New World Order, maka ia termasuk mereka yang pada hakikatnya turut menanti-nanti dan menyambut dengan sukacita kedatangan pucuk pimpinan, yaitu Dajjal

Suatu ketika ihwal Dajjal dibicarakan di hadapan Rasulullah saw. Kemudian beliau bersabda:

”Sungguh fitnah yang terjadi di antara kalian lebih aku takuti dari fitnah Dajjal, dan tiada seseorang yang dapat selamat dari rangkaian fitnah sebelum fitnah Dajjal melainkan akan selamat pula darinya (Dajjal). Dan tiada fitnah yang dibuat sejak adanya dunia ini –baik kecil ataupun besar- kecuali dalam rangka menyongsong fitnah Dajjal.” (HR Ahmad V/389)

Read More..

Sabtu, 29 Desember 2012

Ada 8 Juta Mumi di Kuburan Tanah Mesir


Arkeolog di Mesir berhasil menggali sekira 8 juta mumi hewan selama melakukan ekskavasi kuburan bawah tanah di Saqqara, 19 mil dari Kairo. Mumi tersebut terdiri dari berbagai jenis hewan.

Dilansir dari UPI, Sabtu (5/1/2012), Saqqara banyak menyimpan piramid dan berbagai tanah pekuburan kuno. Penggalian tersebut dilakukan ahli Mesir dari American University, Salima Ikram bersama sebuah tim peneliti pimpinan Paul Nicholson dari CadiffUniversity. Kuburan kuno yang digali itu telah ditemukan sejak 1897 silam.

"Kami mencatat tulang-tulang hewan dan teknik pembuatan mumi yang digunakan untuk menyiapkan hewan-hewan itu," ujar Ikram kepada Ahram Online.


Dia mengatakan bahwa hewan yang dijadikan mumi tidak terbatas pada anjing. Mereka juga menemukan sisa-sisa tubuh kucing serta musang.

"Kami sedang mencoba memahami bagaimana hal tersebut cocok dengan penyembahan pada Anubis. Kuburan bawah tanah itu ditujukan untuk Anubis," paparnya.

Jiwa anjing yang telah dijadikan mumi, kata Ikram, diyakini akan bisa membawa doa seseorang sampai ke dunia setelah mati. Anubis sendiri merupakan dewa mesir kuno yang wujudnya digambarkan memiliki kepala anjing.

"Kedekatan kuburan bawah tanah itu dengan kuil Anubis, yaitu dewa berkepala anjing yang diasosiasikan dengan kuburan dan pembalseman, membuatnya terlihat ditujukan khusus untuk anjing," tambahnya. (yhw)

Read More..

Jumat, 28 Desember 2012

Masuk Islamnya Jerry D Gray


Eramuslim.com Jerry D Gray, penulis sejumlah buku laris, ternyata seorang mualaf yang sangat mencintai Indonesia dengan mengurus naturalisasinya dari warga AS ke WNI, menikah dengan orang Indonesia dan menetap di Jakarta.

“Bagi saya Indonesia itu ibarat surga. Saya sudah melancong ke banyak negara dan di sini saya mendapatkan kedamaian bergaul dan berinteraksi sosial dengan komunitas Muslim terbesar di dunia,” ujar Jerry.

Beristrikan seorang perempuan Tasikmalaya dan dikaruniai seorang anak laki, Jerry menyatakan memiliki banyak kegiatan di Indonesia yang membuat dia makin betah yaitu memberikan pengajian, berbagi pengalaman dan menulis buku.

Tidak banyak orang yang menyangka Jerry D. Gray, warga AS yang pernah menjadi prajurit angkatan udara negara adidaya itu, ternyata seorang mualaf yang tekun beribadah.

Jerry mengatakan, menjalankan ajaran Islam secara kaffah sebagaimana diajarkan dalam kitab suci Al`Quran. Semua itu baru terlaksana setelah berproses dalam waktu cukup lama.

Bagi penulis sejumlah buku di antaranya “Deadly Mist”, “Demokrasi Barbar ala AS` dan “Dosa-dosa Media Amerika” itu, ketertarikan terhadap Islam dimulai justru dari tanah Arab tempat ajaran Islam itu sendiri pertama kali diturunkan kepada Rasul Allah SWT.

Sebagai AU yang ditugaskan di Arab Saudi, ia melihat betapa khusyuk dan ikhlasnya orang menjalankan shalat hingga mau meninggalkan segala aktivitas mereka termasuk berkaitan dengan uang sekalipun.

“Ketika mengalun suara adzan, dipinggir jalan orang pada shalat, karyawan toko dan mall semua shalat dan barang dibiarkan begitu saja namun tidak ada yang hilang. Semua melaksanakan shalat dengan khusuk,” ujar Jerry, yang pernah selama 2,5 tahun menjadi wartawan di sebuah TV swasta di Indonesia itu.

Ia menjadi bingung sekaligus takjub. Setelahnya kesadaran untuk mengenal ajaran Islam langsung tak tertahankan. Ia melihat cahaya iman justru setelah melihat orang-orang melaksanakan Shalat.

Jerry mengaku ketika pertama kali memegang kitab suci Al Qur`an badannya langsung merinding, ketika akan membaca hatinya bergetar dan sejurus kemudian suara tangis mengiringinya membaca terpatah-patah ayat Al Qur`an.

Setelah hatinya merasa mantap ia kemudian memilih menjadi mualaf di Arab Saudi. Keislamannya belum serta merta jadi mantap. Ia pertama kali hanya melaksanakan shalat dua kali dalam seminggu.

“Ketika tertimpa musibah saya bawa shalat, ternyata saya dapatkan ketenangan dan musibah hilang. Setelah itu saya makin rajin shalat,” ujar Jerry yang kini berisitrikan wanita asal Tasikmalaya Jabar itu.

Kini dalam kesehariannya, Jerry seringkali dimintai pandangan-pandangannya tentang Islam, demokrasi, dan terorisme. “Islam itu agama rahmatan lil alamin dan orang Islam bukanlah teroris,” ujar ayah satu anak itu.

Bagi mantan wartawan CNBC itu, Indonesia sebagai negara dengan populasi Islam terbesar di dunia merupakan surga yang ada di dunia. Ia pun kini tengah mengurus naturalisasi dengan menjadi WNI sebagai ranah perjuangannya terhadap Islam

saya tidak pernah bertemu Muslim, mendengar suara adzan atau pun melihat masjid. Meskipun demikian saya berkeyakinan bahwa Yesus bukan anak Tuhan. Pada usia 12 tahun saya sudah berpikir tentang Tuhan. Umur 14, sudah mulai malas ke gereja.

Saya malas pergi ke sana karena tempat itu tidak dapat menghilangkan dahaga saya tentang Tuhan. Saya bosan setiap kali datang selalu disuguhi dengan banyak ucapan haleluya. Padahal yang saya butuhkan adalah pencerahan siapa itu Tuhan dan kejelasan misi hidup saya di dunia ini untuk apa.

Saya percaya adanya Tuhan dan mau masuk surganya Tuhan. Tapi dari agama ini saya mencium something wrong karena saya harus meyakini Yesus sebagai anak Tuhan. Untung saja nenek di rumah sering banyak cerita tentang Tuhan, sehingga saya lebih suka mendengarkan nenek. Selama saya belajar agama kepadanya, ia tidak pernah bilang bahwa Yesus adalah anak Tuhan. Namun sebaliknya, di gereja saya selalu disalahkan, karena tidak mau mengakui Yesus sebagai anak Tuhan.

Kalau Yesus menjadi anak Tuhan, mengapa Musa, Ibrahim dan Adam tidak menjadi anak Tuhan? Padahal, kalau mau, justru Adamlah yang paling berhak menjadi anak Tuhan karena dia tidak punya ibu dan bapak. Keyakinan saya bertambah setelah membaca kisah Musa yang memaksa ingin melihat Tuhan. Musa akhirnya dibolehkan melihat sedikit cahaya Tuhan dari gunung granit yang sangat gelap. Baru saja merefleksikan sedikit cahaya Tuhan, langsung gunung itu goyang-goyang dan sangat menyilaukan, Musa pun pingsan. Berdasarkan kisah itu, kalau benar Yesus anak Tuhan, pasti orang yang melihat Yesus bakal mati atau pingsan. Ini kan tidak, berarti Yesus bukanlah anak Tuhan.

Saya selalu berdoa agar saya diberi petunjuk yang benar tentang Tuhan. Usai mengikuti wajib militer di angkatan udara, saya ditawari menjadi maintenance pesawat pribadi Raja Fadh di Jeddah, Arab Saudi. Saya tolak karena saya takut dibunuh orang Islam. Lebih baik saya menganggur.

Saya tinggal di dalam mobil di ujung satu dermaga di Hawaii. Setiap hari mancing. Bila dapat ikan, saya makan, bila tidak saya kelaparan. Paling hanya minum dari kran air putih yang ada di situ. Enam bulan begitu terus. Pernah tiga hari berturut-turut saya tidak makan sama sekali, hanya minum saja karena tidak dapat ikan. Tapi saya tidak mau bunuh diri. Saya menangis, memohon, agar Tuhan memberikan jalan keluar.

Namun tawaran tersebut datang lagi. Saya mengira Tuhan telah marah kepada saya. Karena saya tidak mendapatkan pekerjaan lain, malah disuruh ke Arab. Akhirnya teman memberikan saran kepada saya untuk menerima tawaran itu. Saya pun berangkat ke sana.

Di Jeddah saya melihat kejadian-kejadian yang sangat luar biasa, yang sangat berbeda dengan bayangan saya sebelumnya. Ternyata orang Islam begitu taat kepada Tuhannya dan baik kepada saya. Ketika mendengar adzan mereka langsung meninggalkan aktivitasnya untuk segera shalat.

Begitu juga ketika saya ke toko emas. Saya dengar adzan. Pintu toko emas terbuka. Padahal di toko tersebut tidak ada orang. Siapa pun yang berniat mencuri emas, akan sangat mudah mengambilnya. Tapi kok ini dibiarkan, Saya berdiri saja di depan toko itu menunggu penjual emas muncul. Setelah adzan, jalanan mendadak sepi dari lalu lalang manusia. Penjaga keamanan tidak ada. Paling sekali-kali saya melihat polisi menegur beberapa orang yang sedang lewat untuk segera shalat.

Tak lama kemudian, pemilik toko itu datang dan berkata “Mengapa tidak masuk?” Saya jawab, “Tidak mau”. “Kenapa tidak mau?” tanyanya. “Saya takut disangka maling, nanti tangan saya dipotong,” jawab saya karena setahu saya orang yang mencuri tangannya akan dipotong. Biasanya orang bule yang datang ke Jeddah diundang untuk menyaksikan pemotongan tangan bagi pencuri setiap Jum’at siang.

“Masuk saja, karena semua ini adalah Allah yang punya, bukan punya saya,” kata pemilik toko itu. “Apa pun, kamu perlu, ambil! Mungkin kamu lebih membutuhkan itu daripada saya?” lanjutnya. Ia mengatakan bahwa semua itu milik Allah dan akan kembali kepada Allah.

Saya terharu dan mau menangis mendengar ucapan yang tulus itu. Saya sangat ingin punya iman seperti itu. Dengar adzan dia shalat. Orang mau mengambil atau tidak mengambil hartanya, dia tidak ada masalah, yang penting ketika Allah menyuruh shalat dia berangkat shalat dan semua hartanya itu dia pasrahkan kepada Allah.

Peristiwa itu membuat saya jadi tertarik untuk mengetahui agama Islam lebih lanjut. Saya jadi banyak diskusi tentang Islam. Termasuk dengan Ahmad, salah seorang anggota Angkatan Udara Arab Saudi. Saya diberinya Alquran dengan terjemah bahasa Inggris.

Ia tunjukkan ayat yang menyatakan Isa anak Maryam adalah hamba dan utusan Allah, bukan anak Allah. Ahmad menyebut Isa itu adalah nama lain dari Yesus, sedangkan Maryam sebutan lain dari Bunda Maria. Kurang lebih tiga ayat saya baca. Saya tidak kuat lagi meneruskan membacanya, karena saya mau menangis. Saya tidak mau menangis di depan orang. Saya sangat yakin, inilah jawaban dari Tuhan. Rupanya saya disuruh ke Jeddah itu bukan karena Tuhan marah, tapi karena Tuhan mengabulkan doa saya.

Kemudian teman Ahmad yang bernama Rosyid, datang ke rumah. Dia memberi tahu bahwa di salah satu masjid di Jeddah malam itu dimulai lagi sekolah Islam yang menggunakan bahasa Inggris. “Kalau kamu ingin tahu lebih banyak tentang Islam datanglah ke masjid tersebut, nanti saya antar,” kata Rosyid. Di sekolah itu terjadilah diskusi. Hati saya berdecak kagum. Luar biasa, pintar sekali guru ini. Semua yang dia katakan masuk akal. Argumennya begitu spiritually and lightening.

Dia mengatakan bahwa Tuhan itu satu bukan tiga, semua adalah ciptaan Tuhan dan bergantung kepada Tuhan. Tuhan tidak beranak tidak pula punya orangtua. Tidak ada yang dapat menyerupai Tuhan. Serta manusia hidup di dunia ini untuk mengabdi kepada Tuhan saja. Belum satu jam pun diskusi, sebenarnya hati saya sudah menerima Islam. Hanya saja saya belum mau menyatakan pada guru.

Malam itu saya tidak bisa tidur. Terus merenungkan ucapan guru. Akhirnya di hari ketiga saya putuskan masuk Islam. Saya ucapkan dua kalimat syahadat. Setelah itu guru berdiri dan cium pipi kanan kiri saya. Guru mengajak semua orang yang ada di situ antri untuk mencium saya. Saya kaget mendapat perlakuan itu. Kemudian saya mengerti bahwa itu adalah ungkapan senang luar biasa dari sesama Muslim.

-Dani Fitriyani-

Read More..

Kamis, 27 Desember 2012

Penglihatan adalah Senjata Utama Iblis


Pernahkah anda bertanya mengapa kelompok penyembah setan menggunakan lambang mata (mata satu)sebagai simbol mereka? Karena mata atau Penglihatan adalah senjata utama iblis untuk menyesatkan manusia, mata memegang peranan amat penting dalam mematikan hati manusia.

“Hendaklah mereka menahan pandangannya, dan memelihara kemaluannya”. (An-Nur : 30 dan 31).

Ibnu Qayyim Al-Jau-ziyyah berkata: “Pandangan mata adalah asal dari seluruh petaka yang menimpa seorang insan. Dari pandangan mata melahirkan lintasan di hati. Lintasan di hati melahirkan pikiran, kemudian timbul syahwat. Dari syahwat lahir keinginan kuat yang akan menjadi kemantapan yang kokoh, dari sini pasti akan terjadi perbuatan di mana tidak ada seorang pun yang dapat mencegah dan menahannya. Karena itulah dinyatakan: “Bersabar menahan pandangan itu lebih mudah daripada bersabar menanggung kepedihan setelahnya.”



Seorang penyair berkata:

Setiap kejadian berawal dari pandangan
dan api yang besar itu berasal dari percikan api yang dianggap kecil
Berapa banyak pandangan mata itu mencapai ke hati pemiliknya
seperti menancapnya anak panah di antara busur dan tali busurnya
Selama seorang hamba membolak-balikkan pandangannya menatap manusia,
dia berdiri di atas bahaya
(Pandangan adalah) kesenangan yang membinasakannya, hunjaman yang memudharatkan.
Maka tidak ada ucapan selamat datang terhadap kesenangan yang justru mendatangkan bahaya. (Ad-Da`u wad Dawa`, hal. 234)



Namun bila kita bisa menggunakan mata untuk melakukan ketaatan kepada Allah maka kita akan mendapatkan balasan yang sangat besar. Sebagaimana diterangkan oleh Rasulullah tentang tujuh golongan yang akan mendapatkan naungan Allah pada hari di mana tiada naungan kecuali naungannya, di antaranya beliau menyebutkan:

“Dan seseorang yang berdzikir kepada Allah sendirian kemudian berlinang air matanya”. (HR Bukhari).

Bukan hanya dengan air mata, mata yang terjaga di saat perang di jalan Allah SWT pun mampu menjadi jaminan seseorang terhindar dari siksa neraka. Sabda Rasulullah SAW, “Tiga mata yang tidak akan melihat siksa neraka, yaitu mata yang terjaga saat perang di jalan Allah, mata yang menangis karena Allah dan mata yang terpelihara dari larangan Allah”. (HR At-Thabrani).

Dalam hadis yang lain Rasulullah SAW bersabda, “Tiga mata tidak akan melihat api neraka, yaitu mata yang tercungkil ketika perang di jalan Allah, mata yang meronda di jalan Allah dan mata yang menangis karena Allah”. (HR Hakim).

Allah memerintahkan kita untuk menjaga pandangan kita dari hal-hal yang di haramkanNya. Allah berfirman:

“Katakanlah kepada orang laki-laki yang beriman: “Hendaklah mereka menahan pandangannya, dan memelihara kemaluannya; yang demikian itu adalah lebih suci bagi mereka, sesungguhnya Allah Maha Mengetahui apa yang mereka perbuat”. Katakanlah kepada wanita yang beriman: Hendaklah mereka menahan pandangannya, dan memelihara kemaluannya, dan janganlah mereka menampakkan perhiasannya, kecuali yang (biasa) nampak daripadanya. Dan hendaklah mereka menutupkan kain kudung ke dadanya, dan janganlah menampakkan perhiasannya, kecuali kepada suami mereka, atau ayah mereka, atau ayah suami mereka, atau putra-putra mereka, atau putra-putra suami mereka, atau saudara-saudara laki-laki mereka, atau putra-putra saudara laki-laki mereka, atau putra-putra saudara perempuan mereka, atau wanita-wanita Islam, atau budak-budak yang mereka miliki, atau pelayan-pelayan laki-laki yang tidak mempunyai keinginan (terhadap wanita) atau anak-anak yang belum mengerti tentang aurat wanita. Dan janganlah mereka memukulkan kakinya agar diketahui perhiasan yang mereka sembunyikan. Dan bertobatlah kamu sekalian kepada Allah, hai orang-orang yang beriman supaya kamu beruntung. (QS. AN Nuur, 30-31)

“Sesungguhnya Allah menetapkan atas anak Adam bagiannya dari zina, dia akan mendapatkannya, tidak mustahil. Maka zinanya mata dengan memandang (yang haram) dan zinanya lisan dengan berbicara, sementara jiwa itu berangan-angan dan berkeinginan. Sedangkan kemaluan yang membenarkan semua itu atau mendustakannya.” (HR. Al-Bukhari)

Read More..

Rabu, 26 Desember 2012

Tahun Baru Masehi : Sejarah Kelam Penghapusan Jejak Islam


Eramuslim.com. Dalam beberapa hari ke depan, tahun 2012 akan segera berganti, dan tahun 2013 akan menjelang. Ini tahun baru Masehi, tentu saja, karena tahun baru Hijriyah telah terjadi satu pekan yang lalu. Bagi kita orang Islam, ada apa dengan tahun baru Masehi?

Sejarah Tahun Baru Masehi

Tahun Baru pertama kali dirayakan pada tanggal 1 Januari 45 SM. Tidak lama setelah Julius Caesar dinobatkan sebagai kaisar Roma, ia memutuskan untuk mengganti penanggalan tradisional Romawi yang telah diciptakan sejak abad ketujuh SM. Dalam mendesain kalender baru ini, Julius Caesar dibantu oleh Sosigenes, seorang ahli astronomi dari Iskandariyah, yang menyarankan agar penanggalan baru itu dibuat dengan mengikuti revolusi matahari, sebagaimana yang dilakukan orang-orang Mesir.


Satu tahun dalam penanggalan baru itu dihitung sebanyak 365 seperempat hari dan Caesar menambahkan 67 hari pada tahun 45 SM sehingga tahun 46 SM dimulai pada 1 Januari. Caesar juga memerintahkan agar setiap empat tahun, satu hari ditambahkan kepada bulan Februari, yang secara teoritis bisa menghindari penyimpangan dalam kalender baru ini. Tidak lama sebelum Caesar terbunuh di tahun 44 SM, dia mengubah nama bulan Quintilis dengan namanya, yaitu Julius atau Juli. Kemudian, nama bulan Sextilis diganti dengan nama pengganti Julius Caesar, Kaisar Augustus, menjadi bulan Agustus.

Perayaan Tahun Baru

Saat ini, tahun baru 1 Januari telah dijadikan sebagai salah satu hari suci umat Kristen. Namun kenyataannya, tahun baru sudah lama menjadi tradisi sekuler yang menjadikannya sebagai hari libur umum nasional untuk semua warga Dunia.

Pada mulanya perayaan ini dirayakan baik oleh orang Yahudi yang dihitung sejak bulan baru pada akhir September. Selanjutnya menurut kalender Julianus, tahun Romawi dimulai pada tanggal 1 Januari. Paus Gregorius XIII mengubahnya menjadi 1 Januari pada tahun 1582 dan hingga kini seluruh dunia merayakannya pada tanggal tersebut.

Perayaan Tahun Baru Zaman Dulu


Seperti kita ketahu, tradisi perayaan tahun baru di beberapa negara terkait dengan ritual keagamaan atau kepercayaan mereka—yang tentu saja sangat bertentangan dengan Islam. Contohnya di Brazil. Pada tengah malam setiap tanggal 1 Januari, orang-orang Brazil berbondong-bondong menuju pantai dengan pakaian putih bersih. Mereka menaburkan bunga di laut, mengubur mangga, pepaya dan semangka di pasir pantai sebagai tanda penghormatan terhadap sang dewa Lemanja—Dewa laut yang terkenal dalam legenda negara Brazil.



Seperti halnya di Brazil, orang Romawi kuno pun saling memberikan hadiah potongan dahan pohon suci untuk merayakan pergantian tahun. Belakangan, mereka saling memberikan kacang atau koin lapis emas dengan gambar Janus, dewa pintu dan semua permulaan. Menurut sejarah, bulan Januari diambil dari nama dewa bermuka dua ini (satu muka menghadap ke depan dan yang satu lagi menghadap ke belakang).


Sedangkan menurut kepercayaan orang Jerman, jika mereka makan sisa hidangan pesta perayaan New Year’s Eve di tanggal 1 Januari, mereka percaya tidak akan kekurangan pangan selama setahun penuh. Bagi orang kristen yang mayoritas menghuni belahan benua Eropa, tahun baru masehi dikaitkan dengan kelahiran Yesus Kristus atau Isa al-Masih, sehingga agama Kristen sering disebut agama Masehi. Masa sebelum Yesus lahir pun disebut tahun Sebelum Masehi (SM) dan sesudah Yesus lahir disebut tahun Masehi.



Pada tanggal 1 Januari orang-orang Amerika mengunjungi sanak-saudara dan teman-teman atau nonton televisi: Parade Bunga Tournament of Roses sebelum lomba futbol Amerika Rose Bowl dilangsungkan di Kalifornia; atau Orange Bowl di Florida; Cotton Bowl di Texas; atau Sugar Bowl di Lousiana. Di Amerika Serikat, kebanyakan perayaan dilakukan malam sebelum tahun baru, pada tanggal 31 Desember, di mana orang-orang pergi ke pesta atau menonton program televisi dari Times Square di jantung kota New York, di mana banyak orang berkumpul. Pada saat lonceng tengah malam berbunyi, sirene dibunyikan, kembang api diledakkan dan orang-orang menerikkan “Selamat Tahun Baru” dan menyanyikan Auld Lang Syne.Di negara-negara lain, termasuk Indonesia? Sama saja!

Bagi kita, orang Islam, merayakan tahun baru Masehi, tentu saja akan semakin ikut andil dalam menghapus jejak-jejak sejarah Islam yang hebat. Sementara beberapa pekan yang lalu, kita semua sudah melewati tahun baru Muharram, dengan sepi tanpa gemuruh apapun. (sa/berbagaisumber)

Read More..

Selasa, 25 Desember 2012

Katolik Sarat Dengan Ritus Paganisme


Eramuslim.com. Menurut penelitian banyak sejarawan Eropa, ada dua kelompok dalam pertempuran di wilayah internal Christian , yaitu Gereja Katolik Vatikan dan Kelompok Kabbalah yang diwakili oleh ordo Sion dan Illuminati . Vatikan dan Kabbalah—memang memiliki kepentingan yang saling bertentangan.

Vatikan yang mengklaim diri sebagai satu-satunya pihak, pewaris yang sah, atas kunci Gereja Yesus Kristus, menyatakan dirinya sebagai Tahta Suci dan semua kekristenan yang ada di dunia ini wajib menginduk kepadanya hingga datangnya Maranatha (The Second Coming) atau hadirnya kembali Yesus dalam wujud Tuhan seutuhnya, yang mereka yakini akan membawa semua umat manusia yang percaya pada Yesus ke dalam surga.


Klaim Vatikan ini sejak awal kekristenan telah ditentang habis oleh Kaum Yohanit (The Yohanit Church Sect) yang menganggap Yesus hanyalah manusia biasa, memiliki keturunan dari perkawinannya dengan Maria Magdalena yang diselenggarakan di Kana—salah satu kota suci Kristen ini sekarang masuk ke dalam wilayah Lebanon-dan mewariskan kunci gerejanya kepada isterinya, Maria Magdalena, bukan kepada Saint Peter, yang ditahbiskan menjadi Paus I.

Pertentangan ini bukan sekadar pertentangan biasa. Bahkan pada 1209-1229, puluhan ribu tentara Salib dari Eropa Utara diperintahkan oleh Paus Innocentius III untuk menggelorakan perang salib membantai ribuan orang-orang Kathari di wilayah pegunungan Albigensian, Perancis Selatan, yang notabene secara resmi juga kristiani. Kaum Kathari atau sebagian sejarawan menyebut mereka sebagai kaum Albigensian, dituduh oleh Gereja sebagai masyarakat yang melakukan heresy (bid’ah) terhadap protokolat religius Vatikan.

Perang Salib Albigensian ini selain memakan korban ribuan kaum Kathari juga telah membunuh ribuan warga Perancis Selatan yang sama sekali tidak bersalah. Seorang komandan lapangan Tentara Salib berkirim surat kepada Vatikan memohon petunjuk bagaimana agar pasukannya bisa memilah mana yang kaum Kathari dan mana yang bukan, surat jawaban dari Vatikan yang diketahui Paus Innocentius III sungguh-sungguh mengejutkan. Surat itu berbunyi:

“Bunuh semuanya! Tuhan akan bisa membedakan mana anak-anaknya dan mana yang bukan. ” Isi surat ini sampai sekarang masih lekat dalam ingatan masyarakat Perancis Selatan yang memang tidak pernah akrab dengan Vatikan.

Kathari atau Albigensian, merupakan pusat dari aktivitas Sekte Gereja Yohanit Eropa abad pertengahan. Ritual mereka banyak yang bersifat esoteris. Di salah satu kota kecil di wilayah ini, Aux en Povence, ajaran Kabbalah yang secara turun-temurun dipelihara dengan lisan, malah dibukukan dan menjadi kitab yang dianggap lebih suci ketimbang kitab apa pun.

Seluruh gereja yang berdiri di wilayah ini mengkultuskan Maria Magdalena dan menganggap Yesus hanyalah manusia biasa. Mereka meyakini The Messiah atau Sang Kristus melekat pada diri Santo Yohanes, bukan Yesus. Sebab itu mereka juga disebut sebagai Sekte Yohanit.



Keanehan Vatikan




Jika dalam sejarah, antara Sekte Yohanit (Kabbalah) dengan Tahta Suci Vatikan, dikenal sebagai seteru yang sangat sengit, namun dalam fakta arsitektural dan ritus Kekatolikan sendiri, ternyata Vatikan teramat banyak—bahkan kental—dengan simbol-simbol paganis-Kabalistik. Salah satunya—dan ini paling menyolok—adalah banyaknya simbol Dewa Matahari (Sol Invictus) dalam Katolikisme.

Misal, kita terbang rendah di atas Saint Peter Square atau Lapangan Saint Peter, tempat di mana jutaan umat Katolik biasa berkumpul bahkan sekadar untuk melihat wajah Paus yang berdiri di atas balkon, Saint Peter Square secara tegas menyimbolkan Simbol Baal dan Ishtar dengan di tengahnya berdiri sebuah Obelisk yang keseluruhannya memiliki arti sebagai Penyembahan Dewa Matahari (Sun Worship).

Simbol yang sama juga terdapat dalam selendang kepausan (Papal Stole). Bahkan di sekujur Gereja Saint Peter, banyak pula ukiran matahari seperti yang tampak di atas balkon kepausan, sebuah tempat di mana Paus biasa menyampaikan pesan-pesannya. Simbol yang sama (Sunburst Monstrance atau disebut juga Ostensorium) juga terdapat di puncak tongkat kepuasan.

Sesungguhnya, bila kita menengok sejarah kekristenan awal, kita akan menemukan bahwa simbol-simbol ini memang telah ‘merasuki’ Kekristenan sejak masa kekuasaan Kaisar Konstantin yang dikenal sebagai pencetus Konsili Nicea 325 M, sebuah konsili yang mungkin paling historis dalam sejarah kekristenan, karena dalam konsili itulah Yesus ‘disahkan’ menjadi Tuhan dalam wujud Trinitas.

Di masa Konstantin, seluruh simbol-simbol pagan Romawi Kuno dimasukkan menjadi simbol-simbol kekristenan dan diberi pengertian yang berbeda dari asalnya semula. Padahal, menurut akar sejarahnya, simbol-simbol ini merupakan bagian yang tak terpisahkan dari ritus kelompok Kabbalah yang di permukaan dianggap sebagai musuh Vatikan.

Selain simbol Dewa Matahari, simbol salib, simbol burung merpati putih, dan nyaris seluruh simbol gereja yang ada sesungguhnya merupakan simbol Paganisme Kabalis. Dan hal itu sampai sekarang, setelah melewati rentang waktu berabad-abad, tetap terpelihara dengan baik. Kenyataan ini sungguh mengherankan dan mencuatkan pertanyaan besar:

“Adakah Tahta Suci Vatikan telah terkontaminasi oleh virus paganisme-Kabalis?” Jawaban atas pertanyaan ini mungkin hanya bisa dikemukakan oleh pakarnya. Wallahu’alam bishawab.(Rz)

Read More..

Kamis, 20 Desember 2012

Under The New World Order

Seperti inilah kondisi kita jika kita berada di bawah kendali New World Order, sebagian mungkin sudah kita rasakan pengaruhnya, apakah anda merasa demikian? Mohon disimak dengan seksama.


Read More..

Jumat, 14 Desember 2012

Mengapa Simbologi Begitu Penting Bagi Yahudi?


Salah seorang remaja muslim resah, akhir-akhir ini ia memiliki kebiasaan aneh. Kebiasaannya itu tampak sepele bagi orang lain, namun tidak bagi dirinya. Tanpa sadar ia kerap mendendangkan lagu cinta terlarang versi The Virgin. Padahal ia tahu betul bahwa lagu itu mengajarkan lesbianisme dan perselingkuhan. Kini pemuda muslim itu berusaha untuk tidak tergoda kembali dengan lagu mesum itu. Namun pertanyaannya, kenapa pemuda itu selama ini bisa terbuai untuk melantuntankannya secara tidak sadar?

Lain lagi dengan kisah salah seorang remaja muslimah yang satu ini. Kasusnya hampir serupa. Entah mengapa ia begitu mengagumi Lady Gaga dan Rihanna, padahal ia sadar betul Rihanna dan Lady Gaga adalah dua wanita berstatus agen Kaballah dalam jagad musik dunia. Lirik lagu Umbrella Rihanna pun menyiratkan bahwa manusia berada dibawah sebuah payung Illuminati. Sebuah filosofi yang kental dalam ajaran paganisme.

Lagi-lagi pertanyaannya serupa, kalau memang remaja putri tersebut telah tahu bagian dari skenario besar yang tengah dilancarkan Rihanna, kenapa justru ia malah mengaguminya?


Yahudi dan Simbologi: Mewaspadai Otak Reptil


Mungkin satu-satunya ras manusia di dunia ini yang begitu terpikat dengan simbol adalah Yahudi. Bagaimana tidak, simbol-simbol perusahaan yang saat ini ada adalah bagian dari simbol mereka. Katakanlah Adidas, MasterCard, Vodavone, IBM, Intel, Coca-Cola, Indosat, dan sebagainya. Tidak hanya pada perusahaan, banyak agen-agen satanisme ini menelurkan simbol-simbolnya lewat logo Grup Band Musik, Logo Klub Sepakbola, merchandishe Piala Dunia hingga syair-syair puitis.

Sampai pada satu titik, penulis bertanya mendalam, kenapa Simbologi seperti “sebuah kepercayaan” dan harga mati bagi Doktrin Yahudi? Disini penulis mencoba untuk tidak melihat dari perspektif teologi, tapi penulis tertarik untuk mengkajinya dalam bingkai kajian psikologis. Sebuah hal yang masih jarang kita teliti.

Simbolisme berkaitan dengan doktrin. Sebuah simbol diciptakan untuk membawa seseorang ke alam pikiran kelompok atau orang yang membuat simbol tersebut. Karena kita berhubungan dengan alam doktrin, berarti kita harus menelaah fungsi otak sebagai “terdakwa” penyerap doktrin. Menurut penelitian, otak manusia adalah suatu organ yang beratnya sekitar 1,5 kg atau sekitar 2 % dari berat tubuh dan dioperasikan dengan bahan bakar glukosa dan oksigen.

Saat bayi dilahirkan, otaknya telah berukuran 1/4 dari ukuran otak dewasa. Otak menyerap sekitar 20 % suplai oksigen yang beredar di dalam tubuh manusia. Semua manusia sejak lahir telah memiliki 100.000.000.000 (seratus miliar) sel otak aktif dan didukung oleh 900.000.000.000 (sembilan ratus miliar) sel pendukung lainnya. Jadi, total ada 1 triliun sel otak. Manusia diberi otak yang sedemikian luar biasa kemampuannya. Namun, ini barulah potensi. Potensi ini harus dikembangkan. Meskipun memiliki jumlah sel otak yang sangat banyak, bukanlah jaminan seseorang dapat menjadi makhluk yang cerdas.



Di dalam kepala manusia terdapat tiga macam otak yang berkembang secara bertahap. Yaitu Otak Reptil, Otak Mamalia, dan Neo Cortex. Otak reptil bermula dari batang otak yang terletak di dasar otak dan terhubung ke tulang belakang. Otak ini berfungsi sebagai pusat kendali, sistem saraf otonomi, dan untuk mengatur fungsi utama tubuh seperti denyut jantung dan pernafasan. Selain itu, otak reptil juga berfungsi mengatur reaksi seseorang terhadap bahaya atau ancaman dengan menggunakan pendekatan “lari” atau “lawan”.

Namun orang tidak menyadari, bahwa pada dasarnya otak Reptil-lah yang menjadi bagian penting dari doktrin simbologi. Otak reptil memiliki fungsi untuk merespon segala hal terhadap apa yang ia dengar dan saksikan, termasuk sebuah simbol. Sifat responsif ini terjadi karena otak reptil memiliki kesamaan dengan otak primitif. Ia tidak mampu maksimal untuk menganalisa, berfikir, mencerna secara intelektual apa-apa saja hal yang menghampirinya. Karena sebagian fungsinya hanya untuk menjalankan fungsi instingtif seperti makan, minum, tidur dan sebagainya.

Jadi ketika Ahmad Dhani banyak melakukan propaganda Simbol Mata Satu dalam video klipnya, otak reptile-lah yang sebenarnya lebih banyak menyerap dan menerima, tanpa banyak mengkritisi. Tujuan dari Yahudi mungkin tidak aneh, bahwa dengan terbiasa sebuah simbol Dajjal tersaji ke muka umum, nantinya manusia tidak akan merasa gagap jika kemudian Dajjal turun.

Karena simbol itu telah memasyarakat lewat propaganda mereka. Oleh karenanya, Rasulullah dengan baiknya telah mencounter propaganda itu jauh-jauh hari, agar manusia memakai otak Neo Cortex-nya saat berbicara tentang Dajjal “Sesungguhnya Allah Ta’ala itu tidak buta sebelah matanya. Ketahuilah. sesungguhnya Al-Masih Ad-Dajjal itu buta sebelah matanya yang kanan, seakan-akan matanya itu buah anggur yang tersembul. ” (Shahih Bukhari)

Neo Cortex sendiri adalah lawan dari otak reptile. Otak ini adalah bagian belahan otak yang kritis, sarat pemikiran, dan tidak mudah tersugesti karena memiliki cara kerja yang menggunakan daya analisis tajam. Karena itu salah seorang Ulama pernah melarang umat Muslim untuk taklid buta terhadap perkataan dari dirinya jika memang salah.

Dalam arti, menerima begitu saja suatu perkara tanpa memakai sebuah nalar dan tuntunan wahyu untuk mencernanya. “Aku hanyalah seorang manusia, terkadang benar dan salah. Maka, telitilah pendapatku. Setiap pendapat yang sesuai dengan al-Quran dan sunnah nabi, maka ambillah. Dan jika tidak sesuai dengan keduanya, maka tinggalkanlah.” (Jami’ Bayan al-’Ilmi wa Fadhlih 2/32).

Bahkan, Allah memerintahkan agar hambaNya bertanya kepada ahlu adz-dzikr, yaitu ulama atau fihak yang lebih berkompetensi jika menghadapi persoalan. “Maka bertanyalah kepada orang yang mempunyai pengetahuan jika kamu tidak mengetahui.” (QS. An-Nahl: 43). Inilah sebuah landasan agar kita selalu waspada dan memakai akal kita, terlebih saat kita menyaksikan propaganda simbolis mereka.

Doktrin Simbologi dan Back Up Gelombang Otak


Selain pengaruh otak Reptil, gelombang otak juga memberikan faktor dominan. Dalam kajian psikologi kognisi, kita mengenal bahwa gelombang otak terdiri dari empat gelombang bagian. Yakni Gelombang Deltha dengan Frekuensi 0,1 - 4 Hz. Thetha dengan frekuensi 4 - 8 Hz, Alpha dengan frekuensi 8-12 Hz , Betha dengan frekuensi 12-25 Hz dan Gamma dengan frekuensi 25 Hz ke atas.

Insting sugestif terhadap simbol, lagu-lagu, serta tampilan visual yang mengandung pesan simbolisme akan maksimal terserap ketika gelombang otak manusia berada pada level kondisi alpha dan thetha. Misalnya ketika kita sedang membaca, menulis, berdoa dan ketika kita fokus pada suatu obyek, yaitu dalam skala 4-12 Hz.

Gelombang alpha sendiri memiliki peran sebagai penghubung pikiran sadar dan bawah sadar. Alpha juga menandakan bahwa seseorang dalam kondisi light trance atau kondisi hypnosis (baca: sugesti) yang ringan. Saat kita dalam kondisi hypnosis, meditasi dalam, hampir tidur, atau tidur disertai mimpi. Frekuensi ini menandakan aktivitas pikiran bawah sadar. Secara alami anda memasuki kondisi alpha dan theta setiap akan tidur dan bangun tidur.

Ketika anda sudah merasa sangat rileks, tenang, dan hampir tertidur, tapi anda masih menyadari keberadaan anda, maka seperti itulah kondisi dimana kita mudah tersugesti. Ketika anda terjaga dari tidur, dan masih malas untuk beranjak dari tempat tidur karena masih ingin melanjutkan tidur lagi, maka seperti itulah kondisi saat doktrin simbologi masuk dengan kondusif.

Bedanya, ketika kita akan memulai tidur, kondisi otak kita mengalami defisit Hertz. Yaitu berada pada kondisi alpha-theta dalam beberapa menit saja, untuk kemudian gelombang otak kita turun ke pososi gelombang delta (tanda bahwa tubuh dan pikiran anda beristirahat total). Sedangkan dalam kondisi orang yang tersugesti, manusia bisa mengalami kondisi trance (gelombang otak alpha-theta) dalam waktu yang lama.

Orang yang bermeditasi, berdoa dengan khusyuk, terpana melihat sesuatu, terhanyut membaca novel atau suatu cerita, melamun dan semacamnya juga menghasilkan gelombang otak alpha sampai theta.

Lalu apa hubungannya antara gelombang Alpha dan Thetha dengan Simbol Yahudi?



Kenyataannya Yahudi tahu betul bahwa manusia tidak selamanya berada pada kondisi Betha yang penuh kesadaran. Dengan sistem medis kafir yang mereka ciptakan, manusia berkubang menjadi individu-individu rentan stress dan mudah tersugesti. Pada saat-saat itulah, Saat manusia letih atas segala aktifitasnya dalam Sistem Dajjal yang penuh fitnah ini, kita telah berada pada satu titik insting sugestif. Simbol-simbol akan masuk menyihir manusia untuk melepaskan penat yang membelenggu diri kita. Baik dengan musik, tayangan Film Holywood, sampai propaganda dalam pertandingan-pertandingan sepakbola.

Jika anda dulu masih jarang mendengar Istilah “Setan Merah”, namun kini kata-kata itu acap sekali terdengar setelah MU melekatkan nama klubnya pada identitas itu. Istilah dan simbol iblis berubah menjadi biasa dan lumrah untuk dilekatkan dalam kehidupan kita. Tengok saja simbol Band Ungu dan Armada Band yang secara tidak sadar telah ikut memakai simbol satanisme dengan dua tanduk menjulang ke atas. Sekali lagi tanpa mereka sadari. Ini baru dalam segi musik dan olahraga.

Selain itu doktrin untuk mensugesti manusia dalam alam Thetha dan Alpha juga terjadi dalam Film Avatar. Penulis pernah memiliki pengalaman unik ketika meriset para murid di tempat penulis mengajar. Saat sebelum menonton, penulis sudah merinci doktrin-doktrin berbahaya apa saja yang termuat dalam film Avatar dan para murid telah memahami seperti konsep Reinkarnasi, Roh Suci, Alam Eywa dan sebagainya. Uniknya setelah satu jam kami bersama-sama menonton, para murid sudah lupa apa misi tujuan dari film ini.

Aksi memikat dan sentuhan psikologis dalam Film Animasi ini ternyata memiliki efek kejut yang sempurna. Film Avatar berhasil membawa para peserta didik untuk justru menjadi bagian dari Avatar dan telah lupa pesan apa yang tersimpan rapih dalam film berdurasi tiga jam ini. “Menakjubkan”!

Alam bawah sadar: Ini salah satu Kunci keberhasilan Simbologi Yahudi


Akhirnya muara dari itu semua akan membawa kita pada pengkajian apa yang sangat fenomenal dalam Piskologi dengan sebutan Alam Bawah Sadar. Sigmund Freud, misalnya, berpendapat bahwa alam bawah sadar adalah sumber dari motivasi dan dorongan yang ada dalam diri kita, apakah itu hasrat yang sederhana seperti makanan atau seks, daya-daya neurotik, atau motif yang mendorong seorang seniman atau ilmuwan berkarya. Namun anehnya, menurut Freud, kita sering terdorong untuk mengingkari atau menghalangi seluruh bentuk motif ini naik ke alam sadar. Oleh karena itu, motif-motif itu kita kenali dalam wujud samar-samar.

Namun sebenarnya, penulis tidak sependapat pada konten seksual dalam alam bawah sadar versi Freud, dan sebenarnya Islam sudah menemukan Konsep alam bawah sadar jauh sebelum Freud. Namun tempat tidak menyediakan ruang untuk kita membahas secara detail disini. Kita hanya cukup membahas pada substansi Alam Bawah Sadarnya.

Alam bawah Sadar memang seperti namanya adalah alam yang sangat unik. Ia mampu mengerakkan jiwa manusia tanpa disadari manusia tersebut.



Masih ingatkah kita dua remaja di atas tadi. Mereka memiliki kebiasaan tanpa sadar untuk kerap menyanyikan lagu-lagu Illuminati. Baik saat mereka sedang melamun, kosong pikiran, bengong, dan sebagainya. Rasanya ada saja sesuatu yang mengerakkan lidah mereka saat mereka menyanyikan lagu itu. Nah itu yang disebut dengan alam bawah sadar. Mungkin anda juga pernah mengalami.

Cara kerja dalam pemrograman alam bawah sadar adalah dengan didahului oleh stimulus eksternal. Stimulus ini kemudian akan melaju untuk diserap aktif oleh panca indera. Setelah itu, panca indera akan mentransfer ke Alam Sadar lewat perasaan dan emosi. Setelah itu ia akan mengendap di alam bawah sadar.

Lagu The Virgin yang memang easy listening dan enak didengar adalah kunci bagaimana sebuah lagu dapat membius seseorang. Kekuatan lirik juga mampu menopang bagian dari misi ini. Dengarlah lirik lagu “Satu” dalam salah satu album milik Ahmad Dhani.

Pendengar mungkin tidak mengira bahwa lagu itu sebenarnya menyebarkan virus wahdatul wujud (Baca sejarah al Hallaj dan Lemah Abang) berupa penyatuan manusia dengan Tuhan. Namun kekuatan lirik yang sangat indah dapat menutupi aksi tersebut. Dan alam bawah sadar merespon lagu itu dengan memuntahakannya dalam jiwa kita bahwa secara tidak sadar kita mengakui kita adalah Tuhan dan Tuhan adalah kita. Setara!

Oleh karenanya, mengapa Raihanna mau melakukan aksi teatrikal dengan biaya mahal saat ia manggung di Amerika dengan aksi pencahayaan yang berada pada wujud All Seeing Eye. Lalu kenapa pula Ahmad Dhani kemudian memakai banyak kata dan simbol Mata Satu dalam lirik lagu Sweetest Place-nya. Sebab, ini adalah bagian dari aksi psikologis tersebut.

Penulis menduga ada beberapa alasan psikologis yang membuat mereka memakai simbol dalam doktrin ini. Pertama, dengan adanya simbol mereka akan mudah untuk menyebarkan misinya. Sebagai contoh Ahmad Dhani dan Lady Gaga. Bahwa dengan simbol mata satu yang giat mereka lancarkan, setidaknya mereka berharap orang nantinya tidak akan aneh dengan kedatangan Dajjal, dan bisa jadi kita tergiring untuk mengikutinya. Kedua, ini adalah doktrin. Lewat simbol itu masyarakat akan terbiasa memakai simbol-simbol Yahudi (Lihat logo UIN dan Indosat) dan menjadi bagian dari trend global mewujudkan Tatanan Dunia Baru. Ini dilakukan oleh Jay Z lewat perusahaan Rock A Fella-nya. Ketiga, mereka ingin menginformasikan kepada dunia bahwa mereka adalah salah satu pengikut dan penganut faham yang sama. Sehingga ketika sistem dajjal sudah siap muncul, maka hampir seluruh pengikutnya pun sudah menyakatan siap menerima kedatangan sang dajjal sebagaimana mereka sudah menunggunya sekian waktu lamanya.

Oleh karenanya, umat Muslim mesti waspada untuk tidak mudah terpengaruh dan senantiasa berfikir analitis dan kritis untuk mengenali propaganda yang tidak sepele ini. Saat ini mereka sedang sangat dengan gencarnya mengkampanyekan kehadiran sang dajjal yang mereka anggap sangat sakral.

Allah ada di Sekeliling Kita!!!

Namun sehebat apapun kekuatan mereka berusaha meracuni kita dengan berbagai modus kehancuran yang mereka ciptakan dan sebarkan kepada hampir seluruh pelosok negeri, lihatlah disekeliling kita Allah pun selalu mengingatkan kita dengan memberi simbol-simbol dan petunjuk yang sama pada umat-Nya. Perhatikan berbagai petunjuk Allah di langit, di laut, di pepophonan, buah-buahan, di daun telinga seorang bayi mungil, di air, di antara awan, dan sebagainya.




Disinilah kita melihat Allah sungguh amat mencintai umatnya, tidak dibiarkan umatnya tersesat dalam kehampaan dan kebingungan ditengah gencarnya kaum hedonis menghauhncurkan iman umat muslim. Allah juga memiliki misi dan tujuan yang sama, yaitu makin menguatkan iman para pengikutnya agar senantiasa berpegang teguh kepada akidah, kitabullah dan sunatullah. 
Demikianlah bentuk dan cara sekelompok orang menyebarkan faham kesesatannya dan demikian jugalah cara Allah meyakinkan umat-Nya bahwa Allah jauh lebih berkuasa atas apa yang ada di alam semesta ini. Sekelompk orang itu mungkin bisa menandai keberadaan mereka diatas secarik kertas atau papan reklame, tetapi lihat lah Allah bahkan bisa menandai dan menamakan diri-Nya di atas langit, di birunya laut dan di sebuah bulan dan bintang sekalipun, subhanallah,. inilah tanda-tanda diantara mahluk yang berpikir. Janganlah lagi kita menyangsikan kekuasaan-Nya, karena sesungguhnya kita hidup di dunia ini hanya sementara dan masih ada alam akhirat sana yang jauh lebih nyata.
 
Oleh sebab itu sebagai kaum muslim yang meyakini keberadaan dan keesaan Allah, mungkin ada baiknya disetiap rumah dan tempat berteduhnya kaum muslimin, hendaknya digantungkan sebuah aksen berlafazkan Allah dan Nabi Muhammad didinding atau sebagai pajangan rumah, atau mungkin juga di gendung-gedung kantor, disamping untuk memberi pertanda bahwa kita adalah umat muslim, juga untuk mendatangkan keberkahan karena Allah saja mau menandakan keberadaaanya di seluruh alam semesta ini, apalah lagi kita yang jelas-jelas sudah menempati sepetak bidang tanah di atasnya, disamping itu dengan adanya aksen tersebut tentunya para pasukan iblis dan setan tidak akan berani mendekat, karena pada dasarnya makna simbiol bagi kaum yahudi juga adalah mendatangkan keburukab bagi penggunanya karena ia juga berkaitan dengan keberadaan makluk halus, yaitu sosok lucifer, baphomet dan isis yang sangat menyukai simbol simbol tertentu. Menurut mereka makna simbol memiliki arti khusus karena dengan bertebarannya simbol-simbol iblis dimuka bumi ini memberi petunjuk kepada semua pasukannya dimuka bumi ini agar bisa menguasai seseorang atau sekelompok orang dalam bentuk penguasaan alam bawah sadar ataupun alam sadar.
 
Disamping kita harus terus menguatkan iman dan taqwa, kita juga harus selalu mengenali modus mereka hingga kita mampu membentengi otak reptile, gelombak alpha dan thetha, serta alam bawah sadar kita untuk selalu tunduk pada-Nya dan kita tidak terjebak pada segala tipu daya iblis. Karena sekalipun Yahudi melakukan tipudaya secara simbologi, kita mesti ingat bahwa sebaik-baiknya makar adalah makar Allah. Wallahua’lam.

Muhammad Pizaro Novelan Tauhidi, Konselor Muslim, Aktif di Kajian Zionisme Internasional dan Peminat Psychology Studies (fiqhislam.com)

Read More..

Rabu, 12 Desember 2012

Perkembangan Embrio Manusia – Keajaiban Ilmiah Al Qur’an


Di dalam al Qur’an Allah menurunkan beberapa ayat tentang perkembangan embrio manusia.

وَلَقَدْ خَلَقْنَا الْإِنْسَانَ مِنْ سُلَالَةٍ مِنْ طِينٍ
ثُمَّ جَعَلْنَاهُ نُطْفَةً فِي قَرَارٍ مَكِينٍ
ثُمَّ خَلَقْنَا النُّطْفَةَ عَلَقَةً فَخَلَقْنَا الْعَلَقَةَ مُضْغَةً فَخَلَقْنَا الْمُضْغَةَ عِظَامًا فَكَسَوْنَا الْعِظَامَ لَحْمًا ثُمَّ أَنْشَأْنَاهُ خَلْقًا آخَرَ ۚ فَتَبَارَكَ اللَّهُ أَحْسَنُ الْخَالِقِينَ

Dan sesungguhnya Kami telah menciptakan manusia dari suatu saripati (berasal) dari tanah. Kemudian Kami jadikan saripati itu air mani (yang disimpan) dalam tempat yang kokoh (rahim). Kemudian air mani itu Kami jadikan segumpal darah, lalu segumpal darah itu Kami jadikan segumpal daging, dan segumpal daging itu Kami jadikan tulang belulang, lalu tulang belulang itu Kami bungkus dengan daging. Kemudian Kami jadikan dia makhluk yang (berbentuk) lain. Maka Maha sucilah Allah, Pencipta Yang Paling Baik. (Al Qur’an, 23:12-14)


Secara bahasa, kata bahasa arab ‘alaqah mempunyai tiga makna: 1. lintah, 2. sesuatu yang menempel/tergantung, dan 3. gumpalan darah.

Jika kita membandingkan sebuah lintah dengan embrio pada fase ‘alaqah, kita akan menemukan kemiripan di antara keduanya, sebagaimana terlihat dalam gambar 1. Selain itu, sang embrio pada fase ini memperoleh makanan melalui aliran darah dari ibunya, mirip dengan lintah yang menghisap darah dari makhluk lain.

Makna ke dua dari kata ‘alaqah adalah sesuatu yang menempel/tergantung. Hal ini dapat kita lihat dalam gambar 2 dan 3, di mana embrio pada fase ‘alaqah, menggantung dan menempel pada rahim sang ibu.

Makna ke tiga dari kata ‘alaqah adalah gumpalan darah. Kita dapat melihat bahwa tampilan luar dari embrio dan kantungnya pada saat fase ‘alaqah sangat mirip dengan darah yang menggumpal. Hal ini disebabkan oleh kehadiran darah yang relatif banyak selama fase ini (lihat gambar 4). Pun pada fase ini, darah di dalam embrio belum mengalami sirkulasi hingga akhir minggu ke tiga. Dengan demikian, embrio pada fase ini memang mirip gumpalan darah.

Jadi, tiga makna dari kata ‘alaqah secara akurat amat bersesuaian dengan keaadaan embrio pada fase ‘alaqah.



Bagaimana bisa Nabi Muhammad mengetahui semua rincian ini lebih dari 1400 tahun yang lalu? Padahal para ilmuwan baru bisa mengetahui hal tersebut di masa moderen ini dengan bantuan peralatan mutakhir dan mikroskop yang amat kuat? Hamm dan Leeuwenhoek adalah ilmuwan pertama yang mengamati sel sperma manusia (spermatozoa) melalui mikroskop di tahun 1677 (lebih dari 1000 tahun setelah jaman Nabi Muhammad). Mereka berdua secara salah menganggap bahwa sel sperma mengandung manusia mini yang akan tumbuh ketika ia dibenihkan ke dalam kelamin wanita.

Di tahun 1981, dalam Konferensi Kedokteran Ke Tujuh di Dammam, Arab Saudi, Profesor Moore berkata: “Adalah sebuah kehormatan tersendiri bagi saya untuk bisa membantu memperjelas pernyataan Al Qur’an tentang perkembangan manusia. Sangat jelas bagi saya bahwa pernyataan tersebut tentulah sampai kepada Nabi Muhammad dari Allah, karena hampir semua pengetahuan mengenai hal ini baru ditemukan berabad-abad kemudian. Hal ini membuktikan kepada saya bahwa Nabi Muhammad tentulah merupakan Utusan Allah.

Kemudian, Profesor Moore ditanya: “Apakah ini berarti bahwa anda mempercayai Al Qur’an merupakan firman Allah?” Ia menjawab: “Saya tidak keberatan untuk menerima hal tersebut.”

Untuk melihat video komentar sang profesor silakan klik tautan berikut ini: (Bahasa Inggris, format RealPlyer)
Video 1



Gambar 1. Bagan yang menggambarkan kemiripan dalam hal penampilan antara lintah dan embrio manusia pada fase 'alaqah.
Gambar 1. Bagan yang menggambarkan kemiripan dalam hal penampilan antara lintah dan embrio manusia pada fase ‘alaqah. (Dari Human Development as Described in the Quran and Sunnah, Moore dkk. hal. 37. Digubah dari Integrated Principles of Zoology, Hickman dkk. Gambar embrio dari The Developing Human, Moore dan Persad, ed. 5, hal. 73)



Kita dapat melihat pada bagan ini bagaimana embrio pada fase 'alaqah bergantung dan menempel di dalam rahim (uterus) sang ibu.
Gambar 2. Kita dapat melihat pada bagan ini bagaimana embrio pada fase ‘alaqah bergantung dan menempel di dalam rahim (uterus) sang ibu. (The Developing Human, Moore dan Persaud, ed 5, hal 66)


Gambar 3. Pada fotomikrograf ini kita dapat melihat bergantungnya embrio (panah B) pada fase 'alaqah (sekitar umur 15 hari) di dalam rahim sang ibu. Ukuran sebenarnya dari embrio ini adalah sekitar 0.6 mm.
Gambar 3. Pada fotomikrograf ini kita dapat melihat bergantungnya embrio (panah B) pada fase ‘alaqah (sekitar umur 15 hari) di dalam rahim sang ibu. Ukuran sebenarnya dari embrio ini adalah sekitar 0.6 mm. (The Developing Human, Moore, ed. 3, hal. 66, dari Histology, Leeson dan Leeson)



Gambar 4. Bagan sistem peredaran darah primitif pada embrio dalam fase 'alaqah. Penampilan luar dari embrio dan kantungnya mirip dengan gumpalan darah karena adanya darah yang relatif banyak di dalam embrio.
Gambar 4. Bagan sistem peredaran darah primitif pada embrio dalam fase ‘alaqah. Penampilan luar dari embrio dan kantungnya mirip dengan gumpalan darah karena adanya darah yang relatif banyak di dalam embrio. (The Developing Human, Moore, ed. 5, hal. 65)/alhabib.info/my/09

Read More..

Selasa, 11 Desember 2012

Yahudi, Sisipkan Slogan Zionisme Dalam Ayat Suci Al Qur’an


YERUSALEM (Berita SuaraMedia) – Kekurangajaran kaum Zionis Israel terhadap umat Islam kembali mengemuka. Dalam sebuah serangan dan penghinaan terbaru dari kaum Zionis terhadap Islam dan simbol-simbol keagamaannya, mereka dengan sengaja memprovokasi perasaan dari umat Muslim.

Kaum Yahudi dengan sengaja memasukkan slogan kerabbian militer Zionis di dalam salinan naskah kitab suci Al Quran! Yang lebih kurang ajar lagi, salinan Al Quran tersebut kemudian dibagi-bagikan kepada para prajurit Muslim yang menjadi anggota tentara penjajahan, demikian dilansir oleh sejumlah media berbahasa Ibrani.


Slogan Zionisme tersebut berbunyi, "Sebuah tanah tanpa penduduk untuk para penduduk tanpa tanah".

Media "Seventh Channel" news menyebutkan bahwa tentara penjajahan Israel memang dengan sengaja menyisipkan slogan Zionisme di seluruh salinan kitab suci Al Quran yang dicetak oleh tentara penjajah Israel. Kemudian, didistribusikan secara gratis kepada para prajurit Muslim.

Menurut media berbahasa Ibrani tersebut, gagasan (mengenai menyelipkan slogan zionisme dalam Al Quran) muncul setelah bertemu dengan kepala rabbi pasukan Perancis, Brigadir Haim Dzih, kala mengunjungi tentara penjajahan Israel. Rabbi militer tersebut membeberkan gagasan licik untuk menyelipkan slogan zionisme dalam Al Quran.

Langkah nista Yahudi tersebut merupakan penghinaan besar bagi kaum Muslim, khususnya ketika Israel membagi-bagikan salinan Al Quran yang telah dimodifikasi tersebut kepada sejumlah besar umat Muslim yang menetap di luar Palestina.

Dalam sebuah majalah khusus untuk para tentara Zionis, Rabbi tersebut mengatakan kepada pasukan Perancis bahwa hal tersebut hanyalah sebuah kesalahan.

Sementara itu, pada hari Selasa pagi, menteri ekstrimis Yahudi, Yitzhak Aharonovitch, membobol masuk kompleks masjid Al Aqsa. Dengan dikawal oleh puluhan petugas dari pasukan penjajahan Zionis.

Para saksi mata menyebutkan bahwa menteri keamanan tersebut berjalan masuk dengan dikawal oleh sejumlah polisi dan para petugas lain di kompleks masjid Al Aqsa, dan juga masjid Kubah Batu.

Polisi Israel mengawal ketat menteri tersebut dan tidak membiarkan ada warga Palestina yang mendekat kepada menteri ekstrimis tersebut.

Hal tersebut semakin menegaskan fakta bahwa pemerintahan Zionis Israel semakin serius membidik masjid Al Aqsa, dan menegaskan bahwa aksi penerobosan tersebut adalah sebuah bukti nyata mengenai rencana kotor Yahudi untuk merobohkan masjid Al Aqsa.

Dalam rencananya, Israel akan menciptakan gempa buatan melalui penanaman bom di sebelah barat Negev, di sebuah laut di Eilat, kemudian orang-orang akan merasakan getaran dari ledakan tersebut, lalu para ilmuwan memberikan keterangan, sementara Israel menyatakan bahwa ada "gempa bumi" melanda daerah tersebut dan menyebabkan atap-atap bangunan menjadi runtuh.

Para ahli menambahkan: "Ada kemungkinan Israel mempergunakan jalur terowongan lebih banyak daripada menggunakan jet F-16 untuk menembus tembok suara masjid tersebut yang dihancurkan oleh serangan penjajahan, Israel sekarang meningkatkan pengalian dan pembangunan terowongan dibawah masjid Al Aqsa dengan tujuan utama yang sangat jahat, yaitu agar fondasi Al Aqsa menjadi rapuh dan setiap saat siap runtuh," Ditekankan bahwa gempa/getaran sekecil apapun akan sedikit menenggelamkan masjid.

Sheikh Saeed Sabri Akrama, kepala pemuka agama Islam di masjid Al Aqsa, dalam sebuah rekaman mengecam keras aksi untuk meruntuhkan situs-situs suci keagamaan di Yerusalem, termasuk masjid Al Aqsa.

Sheikh Sabri mengatakan: "Para rabbi Yahudi terus saja bersikeras bahwa umat Muslim membangun masjid diatas kuil suci mereka pada abad ke tujuh.

Dia menekankan bahwa rencana kotor tersebut adalah kepanjangan dari kegiatan penggalian di bawah masjid Al Aqsa untuk membuat fondasi masjid tersebut menjadi rapuh agar mudah untuk diruntuhkan. Termasuk juga serangkaian kekerasan yang dilakukan oleh kelompok Yahudi ekstrimis terhadap umat Muslim.

"Sama sekali tidak dituliskan dalam kitab suci Al Quran dan hadist, yang merupakan sumber hukum Islam, mengenai adanya "hak" kaum Yahudi atas masjid Al Aqsa, oleh karena itu, Al Aqsa hanyalah tempat suci umat Muslim.

Sheikh Sabri mendesak dunia Arab dan negara-negara Muslim untuk turut memikul tanggung jawab (atas keberadaan masjid Al Aqsa), dan seluruh Muslim harus melindungi masjid Al Aqsa yang terancam akan dirobohkan oleh konspirasi Yahudi.(dn/im) www.suaramedia.com

Read More..

Israel gunakan Burung Elang Sebagai Mata Mata di Sudan


Otoritas Keamanan Sudan mengungkap di Kereinek barat Darfur, seekor Elang yang dilengkapi dengan alat mata-mata canggih buatan Israel.

Pihak berwenang menjelaskan bahwa Elang tersebut membawa alat kecil pada sayapnya bertenaga surya dan tertulis di atasnya dalam bahasa Ibrani “Komisi Israel untuk perlindungan alam”,Universitas Ibrani Yerussalem.


Peralatan tersebut digunakan untuk mentransfer informasi dan foto-foto melalui sistem navigasi “GPS” dan menurut Sky news Elang tersebut menjelajahi wilayah “Kereinek” di Darfur barat.

Pasukan keamanan Sudan telah memeriksa alat tersebut dan mengungkap bahwa alat itu dibuat di Universitas Ibrani di Yerussalem dan terdapat logo Universitas, hal itu berarti alat tersebut di buat di Israel kemudian di selundupkan ke Sudan lalu dipasangkan pada Elang di habitatnya.

Pengungkapan ini datang setelah beberapa minggu lalu militer Israel membom sebuah pabrik militer “Yarmuk” di ibukota Khortum, dengan alasan bahwa senjata tersebut dibuat dan diselundupkan ke Hamas di jalur Gaza. (hr)

Read More..

Buku Mantan CIA Ungkap Rahasia Kotor Pemerintahan AS


WASHINGTON (Berita SuaraMedia) - Hanya beberapa bulan setelah serangan 9 / 11, Amerika Serikat tampaknya telah menangkap otak dalam perang melawan teror terbesar yang baru diluncurkan.

Abu Zubaydah, dianggap sebagai salah satu letnan senior al Qaeda, tergeletak dalam genangan darah di sebuah jalan di Faisalabad, Pakistan, setelah ditembak tiga kali selama serangan terkoordinasi AS di sebuah rumah di mana sekelompok yang dicurigai sebagai teroris sedang menyusun bom. John Kiriakou agen CIA, yang membantu merencanakan serangan, bergegas ke tempat kejadian. Tetapi ketika ia melihat ke arah pria yang terluka kritis, itu tidak cukup tampak seperti orang yang dilihatnya dalam paspor 4-tahunnya.

Dalam buku barunya, "The Reluctant Spy", Kiriakou memberikan pandangan orang dalam kehidupan rahasianya sebagai mata-mata dan perannya dalam perang melawan teror.


Kiriakou mengatakan dia dapat dengan cepat memverifikasi identitas Zubaydah dengan mengirimkan foto telinganya ke markas besar CIA di Virginia. "Saya tidak menyadari sampai malam itu bahwa tidak ada dua orang yang memiliki telinga yang sama. Ini seperti sebuah sidik jari," katanya. Mata-mata Amerika lalu diperintahkan oleh Direktur CIA George Tenet untuk melakukan segalanya dalam kekuasaannya untuk menjaga Zubaydah tetap hidup dan untuk tidak pernah membiarkan dia keluar. Itulah yang Kiriakou lakukan.

Dilarikan ke rumah sakit Pakistan yang kumuh, Zubaydah nyaris berhasil melalui operasi. Kabar rupanya turun kepada al-Qaeda di mana ia sedang dirawat. "Orang-orang Al-Qaeda mulai mengemudi di rumah sakit dan melepaskan tembakan di rumah sakit," kata Kiriakou, dan petugas keamanan Pakistan dengan cepat mengatur agar sebuah helikopter untuk mentransfer Zubaydah ke pangkalan militer. Begitu tiba di pangkalan, Kiriakou menggunakan lembaran seprai untuk mengikat Zubaydah yang koma ke tempat tidurnya dan kemudian berdiri melihat.

Ketika akhirnya Zubaydah bangun, Kiriakou mencoba untuk berbicara dengannya dalam bahasa Arab. Zubaydah menolak, mengatakan padanya dalam bahasa Inggris yang sempurna bahwa ia tidak akan berbicara dalam apa yang disebut "bahasa Tuhan." Anehnya, Kiriakou berkata, Zubaydah lalu meminta segelas anggur merah. Setelah beberapa jam tidur, tahanan memohon Kiriakou untuk membunuhnya - untuk mencekiknya dengan bantal.

Setelah beberapa hari, Zubaydah dipindahkan ke lokasi yang tidak diketahui untuk perawatan lebih lanjut. Itu terakhir kali Kiriakou melihatnya.

Kiriakou mengatakan percakapan dengan Zubaydah yang mengejutkan. "Saya mengharapkan teroris garis keras yang tidak rasional, radikal, penuh kebencian, dan apa yang saya dapatkan adalah seorang pria muda yang ketakutan menyadari bahwa ia kehilangan akal, telah melakukan kesalahan mengerikan dan akan membayar untuk itu."

Kiriakou juga menceritakan ponsel Zubaydah berdering tak lama setelah penangkapannya. Tak seorang pun bisa menjawab itu karena agen-agen FBI yang mengambil bagian dalam serangan telah meletakkan ponsel dalam kantong bukti yang disegel dan menolak untuk membukanya. Kata Kiriakou bukti yang berharga mungkin hilang. "Seharusnya saya membuka tas dan menyambar telepon itu," mantan agen CIA itu berkata.

Irak memainkan peran penting dalam karier CIA Kiriakou, terutama perannya dalam mendukung kebijakan AS untuk pergi berperang.

Pada musim panas 2002, Kiriakou kembali bekerja di kantor pusat di Virginia ketika ia dipanggil ke sebuah pertemuan rahasia. Dia mengatakan bahwa pemerintahan Bush telah memutuskan bahwa Amerika Serikat akan menyerang Irak pada musim semi - itu adalah kesepakatan yang dilakukan . Tugasnya adalah untuk mendukung misi. Kiriakou mengatakan ia tercengang. "Ini adalah seseorang di CIA, jelas dicolokkan ke rencana cabang eksekutif, memberitahu kita bahwa debat publik di Kongres, tercermin hampir setiap hari di media massa, tidak berarti apa-apa." Beberapa bulan kemudian, Kongres meloloskan resolusi perang.

Buku ini dipenuhi dengan lebih banyak cerita tentang pengalaman Kiriakou sebagai mata-mata, termasuk bagaimana ia mencoba untuk menghindari pengawasan di Yunani dan menemukan dia sedang diikuti, itu seperti bertanggung jawab atas agen asing, dan takut serangan yang tertunda tepat sebelum 11 September 2001.

Kiriakou juga membahas bagaimana CIA menggunakan teknik interogasi keras pada tahanan.

Pada tahun 2007, beberapa tahun setelah ia meninggalkan agen tersebut, Kiriakou adalah pejabat pertama yang mengkonfirmasi kepada publik mengenai rahasia terburuk Washington: Zubaydah yang telah ditenggelamkan. Ia tidak memiliki pengetahuan langsung, tapi ia mengatakan ia telah membaca kabel yang menunjukkan teknik simulasi tenggelam digunakan sekali saja, karena Zubaydah membuka mulut dan menyediakan intelijen yang dapat dilaksanakan.

Namun, sebuah laporan pemerintah yang dirilis pada musim panas 2009 mengatakan, teknik ini sebenarnya digunakan 83 kali melawan Zubaydah. Kiriakou mengatakan ia sekarang ia merasa tertipu oleh agensi. Dia mempertanyakan apakah informasi yang berguna benar-benar datang dari tahanan dan mengatakan ia percaya "itu menyebabkan kerusakan lebih parah dan tak sepadan pada prestise negara kita."

Kiriakou meninggalkan CIA pada tahun 2004 setelah menjalani hukuman 14 tahun di badan itu. Dia sekarang penyelidik senior di Komite Senat Hubungan Luar Negeri. (iw/cnn) www.suaramedia.com

Read More..

Senin, 10 Desember 2012

Ujian Hidup Untuk Menjadi Lebih Mulia


eramuslim.com
Kata orang, hidup ini layaknya roda kehidupan. Kadang berada di atas, kadang berada di bawah. Ada pula yang bilang hidup ini seperti ombak di pantai. Kadang tenang, namun tak jarang pula menghantarkan gelombang yang begitu kencang. Apa pun perumpamaan manusia terhadap kehidupan ini, intinya adalah hidup ini takkan setenang air di dalam kolam. Akan ada goncangan-goncangan, hambatan-hambatan, dan ujian-ujian yang bermacam-macam bentuknya.


Terkadang manusia seringkali merasa tidak mampu untuk menghadapi cobaan-cobaan hidup. Bahkan banyak pula yang tak menyadari bahwa semua nikmat dan semua ujian itu hanya berasal dari satu sumber. Semua itu berasal dari pemilik seluruh jiwa-jiwa manusia dan penguasa seluruh hati-hati manusia, yaitu Allah, Sang Maha Kuasa. Parahnya, ada juga yang menyesali diri sendiri, menganggap nasib diri terlalu sial, sehingga tak pernah mendapatkan kebahagiaan dalam hidup.

Mungkin anda pernah dengar cerita sebuah cangkir cantik yang dipajang di sebuah etalase toko. Sebelum berada di sana, ia hanyalah seonggok tanah liat yang sama sekali tidak dihiraukan orang. Kemudian seorang pengrajin mengambil dirinya, membentuk tanah liat itu, kemudian membakarnya di dalam perapian. Sang tanah liat sempat marah dan benci terhadap perlakuan yang diterimanya. Ia harus menahan sakit dan kepanasan. Tak sampai di situ, ia harus rela dicat dengan berbagai warna, kemudian dibakar lagi. Segala macam perlakuan sungguh tidak mengenakkan baginya. Namun apa yang terjadi, setelah semua proses selesai, sang tanah liat mendapati dirinya telah menjadi sebuah cangkir cantik. Ia bukan lagi seonggok tanah liat yang bau, tapi ia telah menjadi sosok baru dan tentu saja lebih baik. *

Mungkin kita sebagai manusia, seringkali berpikir seperti tanah liat tadi. Ujian-ujian yang mendatangi di setiap detik kehidupan selalu ditanggapi dengan ketidaksabaran, keluh kesah, dan ketidakikhlasan. Tak jarang mungkin di antara kita merasa terlalu dibebani dengan amanah-amanah, merasa hanya diri sendiri yang diberi ujian, sedang orang lain bisa bersenang-senang, dan ada juga yang justru berhenti dan tidak mau lagi berbuat karena merasa terlalu lelah, fatigue, dan kecewa. Belum lagi kondisi lingkungan, keluarga, dan teman-teman yang seringkali cuek, tidak perduli, dan sibuk dengan urusan masing-masing.

Tapi cobalah kita lihat kisah si gelas cantik tadi. Lihatlah, betapa setelah semua proses berlalu, seonggok tanah liat telah menjadi sebuah gelas cantik. Betapa indahnya perubahan itu. Saat ini anda mungkin sedang diuji berbagai macam masalah, mulai dari masalah di keluarga, orang tua, teman-teman, tempat kerja, bahkan amanah dakwah sekalipun, tapi percayalah bahwa Allah sedang membentuk anda. Bisa jadi anda tidak menyukai bentukan itu, tapi anda harus sabar. Bukankah selalu ada kemudahan setelah kesusahan? Ingat, awan tak selamanya mendung, sekali waktu ia akan cerah berawan menaungi langit. Bahkan angin topan pun tak selamanya meniupkan angin kencangnya, pada waktunya ia akan tenang dan reda kembali.

Dulu, seorang teman pernah bilang, kalau merasa diri sedang mendapatkan ujian yang begitu berat, berbaik sangkalah kepada diri sendiri dan kepada Allah. Ingat bahwa Allah selalu menurut persangkaan hamba-Nya. Anggap saja saat diuji dengan berbagai masalah, anda sedang dalam masa ujian layaknya anak sekolah. Untuk bisa naik tingkat, harus ada ujian untuk menguji kesiapan. Makin tinggi tingkat, makin tinggi pula level kerumitan ujian yang diberikan. Percayalah, kalau anda berhasil menghadapi ujian ini, anda akan berhasil naik tingkat di mata Allah, menjadi mukmin sejati. Allah tidak akan memberikan suatu ujian sesuai dengan kemampuan hamba-Nya. Kalau Allah saja yakin kita mampu, masa kita sendiri tidak yakin dengan kemampuan diri?

Buat saudara-saudaraku yang saat ini sedang diuji oleh Allah, apapun bentuk ujian itu, bergembiralah dan bersabarlah. Bergembira karena ujian berarti Allah masih peduli dan sayang kepada kita, untuk itu ia memberikan ujian agar kita lebih kuat, lebih bijak, dan lebih mulia. Allah ingin kita menjadi lebih baik di hadapan-Nya. Setelah itu, bersabarlah karena sesungguhnya kesabaran akan membuahkan ketenangan jiwa, kekuatan hati, dan sungguh Allah selalu bersama orang-orang yang sabar. Bersabarlah, karena Allah tidak akan meninggalkan hamba-Nya yang beriman, justru manusia lah yang seringkali meninggalkan sang penciptanya.

Apakah yang diperoleh orang-orang yang telah kehilangan Allah dari dalam dirinya? Dan apakah yang harus dicari oleh orang-orang yang telah menemukan Allah di dalam dirinya? Sungguh antara yang pertama dan kedua tidak akan pernah sama. Orang kedua akan mendapatkan segalanya, dan orang pertama akan kehilangan segalanya.

***

Wallahualam

*kisah disadur dari buku “Kekuatan Cinta”
**disadur dari buku “La Tahzan!”

Read More..

Mari Berkaca dari Struktur DNA Kita


Setiap mahluk hidup tersusun dari kumpulan sel-sel yang beraktivitas sesuai tugasnya. Tubuh manusia, misalnya, tersusun atas lebih dari 10 trilyun sel yang pada awalnya adalah berasal dari hasil pembelahan sebuah sel saja. Di dalam setiap sel terdapat inti sel (nucleus) yang dimana beberapa kromosom (23 pasang) terletak. Kromosom sendiri adalah kumpulan protein dan deoxyribonucleic acid (DNA).


DNA membawa semua informasi genetik mengenai tubuh kita yang nantinya akan diwariskan kepada generasi berikutnya. Jika kita bayangkan DNA sebagai sebuah buku, yang berisi berbagai informasi yang tertulis dari 23 bab (kromosomes) dimana di setiap kromosom terdapat ribuan informasi cerita (genes). Berbeda dengan kita yang menuliskan informasi dengan 26 huruf alphabet, di dalam buku DNA ini setiap kata dituliskan hanya dengan menggunakan 4 huruf yakni A, C, T, dan G.

Contoh tulisannya adalah sebagai berikut: ATGCTGATCGATGCAGAATCGATC…

Panjang informasi yang ada di DNA sekitar 3,000,000,000 huruf yang kalau kita bacakan setiap hari selama 8 jam/hari, butuh 100 tahun untuk menyelesaikannya.

Didalam setiap sel terdapat lebih dari 20,000 gen (yang merupakan bagian dari DNA) yang kita ketahui saat ini yang mempunyai tugasnya masing-masing di dalam tubuh kita. Gen pada dasarnya menghasilkan protein yang digunakan untuk membangun tubuh kita. Setiap gene bertugas untuk menghasilkan protein yang berbeda (setiap gene memproduksi sekitar 10 protein yang berbeda-beda). Gen melalui protein yang dihasilkan akan menentukan bagaimana karakteristik kita (baik struktural, biokimiawi, fisiologis, dan perilaku) yang dikenal dengan istilah fenotipe. Intinya gen lah yang membuat kita bermata biru, berambut pirang atau berbadan tinggi.

Gene juga yang mengatur bagaimana kita memproses makanan secara efficient, men– detoksi- kan racun dan lain sebagainya.

Meski setiap gen memiliki fungsi tersendiri, mereka bekerja, berkolaborasi dalam grup atau jaringan (yang disebut genetic pathways), baik jaringan (network) kecil maupun jaringan yang sangat besar untuk melaksanakan fungsinya yang khusus (metabolisme). Mereka saling berinteraksi dan saling membutuhkan. Jaringan –jaringan ini sangat rumit yang hingga kini para peneliti berusaha untuk mengerti dan menyerderhanakannya.

Jika sebuah gen rusak atau berubah/bermutasi maka seluruh jaringan dimana gen tersebut berada akan juga terkena imbasnya.

Sebuah sistem yang sangat besar yang sangat rumit yang terjadi pada saat ini pada diri kita. Melihat semua kerumitan sistem tersebut ada beberapa hal yang dapat kita renungkan dan ambil hikmahnya:

1. Besarnya nikmat Allah SWT kepada kita.

Kita tidak perlu mengatur (apalagi membuat) semua hal tersebut, Allah sudah memberikan secara “gratis” kepada kita.

Fabiayyi ala i rabbikuma tukadziban? “Maka nikmat Tuhan kamu yang manakah yang kamu dustakan? Sebuah ayat yang diulang oleh Allah sampai sekitar 30x.

“Apabila kamu menghitung nikmat Allah (yang diberikan kepadamu) maka engkau tidak akan mampu (karena terlalu banyak). An-Nahl: 18.

Melihat besarnya nikmat Allah ini sangatlah layak kalau kita bersyukur sebagaimana firman Allah: “Sesungguhnya kami telah menciptakan manusia dari setetes air mani yang bercampur. Kami hendak mengujinya dengan beban perintah dan larangan. Karena itu kami jadikan ia mendengar dan melihat. sesungguhnya kami telah menunjukinya jalan yang lurus: Ada yang bersyukur, namun ada pula yang kafir. (Al-Insan: 2-3)

2. Ukhuwah Islamiyah.

Kita harusnya bekerja layaknya gen dalam sebuah jaringan besar untuk mencapai tujuan/goal yg sama. Setiap kita, muslim/muslimah, punya tugas masing-masing namun dalam satu jalinan/network yang setiap kita adalah pemain dengan tugas yang diberikan kepada kita, tidak saling berebut tugas atau malah melemparkan tugas. Seperti tim sepak bola, ada yang bertugas menjaga gawang, ada yg mencetak gol. Bermain bola tidak hanya untuk mencetak gol tapi juga bagimana kita tidak kemasukkan gol, semua pemain memiliki peran yang sama besarnya..

Bukankah “Perumpamaan seorang mukmin dengan mukmin lainnya dalam kelembutan dan kasih sayang, bagaikan satu tubuh. Jika ada bagian tubuh yang merasa sakit, maka seluruh bagian tubuh lainnya turut merasakannya” (HR. Imam Muslim).

3. Bukti kebesaran Allah dan Hidayah Allah

Semua kerumitan dalam system tubuh kita adalah bukti kebesaran Allah SWT sebagaimana dalam firman Nya:

“Kami akan memperlihatkan kepada mereka tandatanda (kekuasaan) Kami di segala wilayah bumi dan pada diri mereka sendiri, hingga jelas bagi mereka

bahwa Al-Qur’an itu adalah benar. Tiadakah cukup bahwa sesungguhnya Tuhanmu menjadi saksi atas segala sesuatu?”

Dari proses rumit yang terjadi didalam tubuh kita, kita dan kebanyakan peneliti tentunya akan bertanya-tanya, siapa kah yang, mengajarkan setiap gen untuk melakukan fungsinya masing-masing. Siapa kah yang mengatur, mengkoordinasi jaringan tersebut, (siapa yang menjadi keeper, siapa yang menjadi midfielder) dan yang jelas siapa kah yang menciptakan mereka?

Bagi kita umat Islam, tentu tahu jawaban dari semua pertanyaan mendasar itu, yaitu ALLAH Yang Maha Kuasa. Namun kebanyakan dari peneliti yang setiap hari menyaksikan kebesaran Allah ini tidak tergerak hatinya menuju Allah.

Alhamdulillah bagi kita yang telah diberikan hidayah ke dalam hati kita karena tidak semua orang akan diberika hidayah kecuali dengan izinNya: “Sesungguhnya kamu tidak akan dapat memberi petunjuk kepada orang yang kamu kasihi, tetapi Alloh memberi petunjuk kepada orang yang dikehendaki-Nya, dan Allah lebih mengetahui orang-orang yang mau menerima petunjuk.” (QS Al Qashash: 56).

Masih banyak lagi hikmah yang didapat dari baik dari system DNA kita maupun alam sekitar. Kita dapat mengenal Allah tidak hanya dengan mempelajari ayat Qauliyah, tapi juga dengan memperhatikan alam sekitar, yang merupakan ayat-ayat kauniah. Wallahu a’lam bish-shawab.

Tio

Stockholm Sweden
http://www.eramuslim.com/
hafidztio@yahoo.com

Read More..

Sabtu, 08 Desember 2012

Berpikirlah Positif dan Rasakan Keajaibannya

Hidayatullah.com PERNAHKAH Anda mendengar atau membaca kisah sukses Abdurrahman bin ’Auf. Sahabat Rasulullah yang dijamin masuk surga ini adalah cermin yang mesti kita tiru dalam hidup ini. Kesuksesannya berbisnis tak membuatnya sombong dan berbangga diri, tapi sebaliknya ia tetap menunjukkan kebersahajaan dan keikhlasannya untuk berbagi bahkan berbagi sesuatu yang paling ia cintai.

Salah satu yang menarik diri pribadi beliau adalah keyakinannya yang baik akan potensi dirinya. Kalimat yang pernah terluncur dari lisan beliau yang mashyur adalah, “Sungguh, kulihat diriku, seandainya aku mengangkat batu niscaya kutemukan di bawahnya emas dan perak……!” Abdurrahman bin Auf memberikan contoh konsep diri yang baik kepada kita. Konsep diri berupa keyakinan akan potensi yang luar biasa yang ada pada setiap diri manusia.


Kalimat di atas adalah bukan isyarat kesombongan dari seorang Abdurrahman bin ’Auf tapi sebuah pikiran positif terhadap potensi yang diberikan Allah kepada setiap hamba-Nya.

Karena sesungguhnya karunia Allah begitu luas di muka bumi maupun langit ini. Persoalannya tinggal bagaimana kita mampu menggali potensi lalu mengembangkan potensi dan karunia Allah tersebut. Sehingga kita mampu mendapatkan manfaat dan memberikan manfaat kepada orang lain.

Abdurrahman bin ’Auf telah membuktikan bahwa untuk mencapai kesuksesan modal awal yang harus dimiliki setiap insan adalah berpikir positif terhadap dirinya, yakni memberikan kepercayaan, keyakinan akan potensi besar yang ada pada dirinya. Setelah meyakini diri sendiri, Abdurrahman bin ’Auf mencontohkan kepada kita bagaimana bagaimana ia membangun keyakinan akan kekuasaan Allah.

Yakinlah, bahwa Allah tak pernah tidur. Allah akan memberikan apapun yang diminta hamba-Nya, selagi hambanya melakukan ikhtiar yang maksimal untuk membuktikan pikiran positifnya tersebut.

Abdurrahman bin Auf mengatakan, ”Seandainya aku mengangkat batu niscaya ketemukan di bawahnya emas dan perak ….!”

Tahukah Anda apa isyarat apa yang mau digambarkan Abdurrahman bin ’Auf tersebut? Ia sedang mengisyaratkan jika hamba-hamba Allah mau bekerja, berjuang, berikhtiar dan melakukan kreatifitas maka pasti akan menghasilkan sesuatu yang memberikan manfaat kepada dirinya.

Konsep di atas bukan isapan jempol, Kita tahu bahwa Abdurrahman bin ’Auf adalah sahabat terkaya di Mekkah. Pasti kita juga masih ingat kisah hijrah penduduk Mekkah ke Madinah.

Hijrah yang dilakukan nabi dan para sahabat muhajirin mengharuskan Abdurrahman bin ’Auf meninggalkan harta kekayaannya. Seperti juga sahabat lainnya Abdurrahman bin ’Auf hanya membawa harta secukupnya untuk di bawa ke Madinah. Ia adalah sosok manusia yang tidak menggenggam hartanya di hati, ia bisa mengikhlaskan apa yang ia tinggalkan tersebut.

Maka, ketika di sampai di Madinah sahabat anshor menawarkan kepadanya harta kekayaan karena mereka tahu bahwa Abdurahman adalah orang kaya yang telah meninggalkan hartanya untuk hijrah ke Madina mengikuti perintah nabi. Tapi, Abdurrahman bin ’Auf menolak tawaran harta sahabat Anshor tersebut. Ia lebih memilih untuk diberitahu di mana pasar berada. Ia ingin memulai bisnis baru di Madinah. Apakah yang diperdagangkan Abdurrahman bin ’Auf? Ia memulai bisnis tali pengikat kuda. Dan inilah awal bisnis Abdurrahman bin ’Auf yang selanjutnya mengembalikan hartanya yang telah ia tinggalkan. Abdurrahman bin ’Auf sukses berbisnis di Madinah.

Apa pelajaran yang perlu kita ambil dari cerita di atas adalah bahwa modal kesuksesan adalah tidak semata faktor modal materi dan pendidikan yang tinggi. Sukses selalu diawali oleh pikiran positif seseorang dalam memandang dirinya, meyakini kekuasaan Allah dan cara pandang terhadap kehidupan yang akan ia jalani. Ketika kita berpikir positif, kita pasti mampu menghasilkan sesuatu. Kita akan lebih banyak berkreasi dari pada bereaksi karena kita akan lebih fokus mencapai tujuan kita dari pada memikirkan hal-hal negatif yang mungkin saja terjadi dalam kehidupan kita.

Robert J. Hasting pernah berkata, “Tempat dan keadaan tidak menjamin kebahagiaan. Kita sendirilah yang harus memutuskan apakah kita ingin bahagia atau tidak. Dan begitu kita mengambil keputusan, maka kebahagiaan itu akan datang”.

Sekarang saatnya diri Anda memutuskan apakah Anda ingin menjadi pribadi sukses atau menjadi pecundang yang terus berpikir kalah dan gagal. Pastikan diri kita adalah pemenang!*

Nur Jamaludin, kandidat Master of Economics di International Islamic University Malaysia (IIUM), Anggota ISFI (Islamic Studies Forum for Indonesia) Kuala Lumpur Malaysia

Red: Cholis Akbar

Read More..