Senin, 10 Desember 2012

Mari Berkaca dari Struktur DNA Kita


Setiap mahluk hidup tersusun dari kumpulan sel-sel yang beraktivitas sesuai tugasnya. Tubuh manusia, misalnya, tersusun atas lebih dari 10 trilyun sel yang pada awalnya adalah berasal dari hasil pembelahan sebuah sel saja. Di dalam setiap sel terdapat inti sel (nucleus) yang dimana beberapa kromosom (23 pasang) terletak. Kromosom sendiri adalah kumpulan protein dan deoxyribonucleic acid (DNA).


DNA membawa semua informasi genetik mengenai tubuh kita yang nantinya akan diwariskan kepada generasi berikutnya. Jika kita bayangkan DNA sebagai sebuah buku, yang berisi berbagai informasi yang tertulis dari 23 bab (kromosomes) dimana di setiap kromosom terdapat ribuan informasi cerita (genes). Berbeda dengan kita yang menuliskan informasi dengan 26 huruf alphabet, di dalam buku DNA ini setiap kata dituliskan hanya dengan menggunakan 4 huruf yakni A, C, T, dan G.

Contoh tulisannya adalah sebagai berikut: ATGCTGATCGATGCAGAATCGATC…

Panjang informasi yang ada di DNA sekitar 3,000,000,000 huruf yang kalau kita bacakan setiap hari selama 8 jam/hari, butuh 100 tahun untuk menyelesaikannya.

Didalam setiap sel terdapat lebih dari 20,000 gen (yang merupakan bagian dari DNA) yang kita ketahui saat ini yang mempunyai tugasnya masing-masing di dalam tubuh kita. Gen pada dasarnya menghasilkan protein yang digunakan untuk membangun tubuh kita. Setiap gene bertugas untuk menghasilkan protein yang berbeda (setiap gene memproduksi sekitar 10 protein yang berbeda-beda). Gen melalui protein yang dihasilkan akan menentukan bagaimana karakteristik kita (baik struktural, biokimiawi, fisiologis, dan perilaku) yang dikenal dengan istilah fenotipe. Intinya gen lah yang membuat kita bermata biru, berambut pirang atau berbadan tinggi.

Gene juga yang mengatur bagaimana kita memproses makanan secara efficient, men– detoksi- kan racun dan lain sebagainya.

Meski setiap gen memiliki fungsi tersendiri, mereka bekerja, berkolaborasi dalam grup atau jaringan (yang disebut genetic pathways), baik jaringan (network) kecil maupun jaringan yang sangat besar untuk melaksanakan fungsinya yang khusus (metabolisme). Mereka saling berinteraksi dan saling membutuhkan. Jaringan –jaringan ini sangat rumit yang hingga kini para peneliti berusaha untuk mengerti dan menyerderhanakannya.

Jika sebuah gen rusak atau berubah/bermutasi maka seluruh jaringan dimana gen tersebut berada akan juga terkena imbasnya.

Sebuah sistem yang sangat besar yang sangat rumit yang terjadi pada saat ini pada diri kita. Melihat semua kerumitan sistem tersebut ada beberapa hal yang dapat kita renungkan dan ambil hikmahnya:

1. Besarnya nikmat Allah SWT kepada kita.

Kita tidak perlu mengatur (apalagi membuat) semua hal tersebut, Allah sudah memberikan secara “gratis” kepada kita.

Fabiayyi ala i rabbikuma tukadziban? “Maka nikmat Tuhan kamu yang manakah yang kamu dustakan? Sebuah ayat yang diulang oleh Allah sampai sekitar 30x.

“Apabila kamu menghitung nikmat Allah (yang diberikan kepadamu) maka engkau tidak akan mampu (karena terlalu banyak). An-Nahl: 18.

Melihat besarnya nikmat Allah ini sangatlah layak kalau kita bersyukur sebagaimana firman Allah: “Sesungguhnya kami telah menciptakan manusia dari setetes air mani yang bercampur. Kami hendak mengujinya dengan beban perintah dan larangan. Karena itu kami jadikan ia mendengar dan melihat. sesungguhnya kami telah menunjukinya jalan yang lurus: Ada yang bersyukur, namun ada pula yang kafir. (Al-Insan: 2-3)

2. Ukhuwah Islamiyah.

Kita harusnya bekerja layaknya gen dalam sebuah jaringan besar untuk mencapai tujuan/goal yg sama. Setiap kita, muslim/muslimah, punya tugas masing-masing namun dalam satu jalinan/network yang setiap kita adalah pemain dengan tugas yang diberikan kepada kita, tidak saling berebut tugas atau malah melemparkan tugas. Seperti tim sepak bola, ada yang bertugas menjaga gawang, ada yg mencetak gol. Bermain bola tidak hanya untuk mencetak gol tapi juga bagimana kita tidak kemasukkan gol, semua pemain memiliki peran yang sama besarnya..

Bukankah “Perumpamaan seorang mukmin dengan mukmin lainnya dalam kelembutan dan kasih sayang, bagaikan satu tubuh. Jika ada bagian tubuh yang merasa sakit, maka seluruh bagian tubuh lainnya turut merasakannya” (HR. Imam Muslim).

3. Bukti kebesaran Allah dan Hidayah Allah

Semua kerumitan dalam system tubuh kita adalah bukti kebesaran Allah SWT sebagaimana dalam firman Nya:

“Kami akan memperlihatkan kepada mereka tandatanda (kekuasaan) Kami di segala wilayah bumi dan pada diri mereka sendiri, hingga jelas bagi mereka

bahwa Al-Qur’an itu adalah benar. Tiadakah cukup bahwa sesungguhnya Tuhanmu menjadi saksi atas segala sesuatu?”

Dari proses rumit yang terjadi didalam tubuh kita, kita dan kebanyakan peneliti tentunya akan bertanya-tanya, siapa kah yang, mengajarkan setiap gen untuk melakukan fungsinya masing-masing. Siapa kah yang mengatur, mengkoordinasi jaringan tersebut, (siapa yang menjadi keeper, siapa yang menjadi midfielder) dan yang jelas siapa kah yang menciptakan mereka?

Bagi kita umat Islam, tentu tahu jawaban dari semua pertanyaan mendasar itu, yaitu ALLAH Yang Maha Kuasa. Namun kebanyakan dari peneliti yang setiap hari menyaksikan kebesaran Allah ini tidak tergerak hatinya menuju Allah.

Alhamdulillah bagi kita yang telah diberikan hidayah ke dalam hati kita karena tidak semua orang akan diberika hidayah kecuali dengan izinNya: “Sesungguhnya kamu tidak akan dapat memberi petunjuk kepada orang yang kamu kasihi, tetapi Alloh memberi petunjuk kepada orang yang dikehendaki-Nya, dan Allah lebih mengetahui orang-orang yang mau menerima petunjuk.” (QS Al Qashash: 56).

Masih banyak lagi hikmah yang didapat dari baik dari system DNA kita maupun alam sekitar. Kita dapat mengenal Allah tidak hanya dengan mempelajari ayat Qauliyah, tapi juga dengan memperhatikan alam sekitar, yang merupakan ayat-ayat kauniah. Wallahu a’lam bish-shawab.

Tio

Stockholm Sweden
http://www.eramuslim.com/
hafidztio@yahoo.com

Artikel Terkait:

Tidak ada komentar:

Poskan Komentar